Self reinforcing strategies
I did wonder whether there might be an issue until 'all builds including bad ones' are synthesised with the ordering for the strategy mar...
Edward Lane
Joined on October 13, 2011
8
Likes received
36
Conversations posted
103
Replies posted
82
Conversations followed
Conversations
Expanding Clollin's nano machine idea (wild thinking)
Just thinking about it Clollin's comments in the nano machine puzzle (just a bit in a slightly crazy manner)
I think probably the eas...
copies of the same chain - how do they interact
If I start with a sequence GGGGGGUUUUUUUUUCCCCCC - I have no problem seeing that forms a nice simple hairpin.
But what happens if I we...