all possible labs,

  • 1
  • Idea
  • Updated 8 years ago
Building puzzles
another way

at the moment I have to create something like
..........((((((((.....))))((((((((.....))))((((.....)))))))))))).........................

and then solve it, and then (and only then can I publish it)

you could remove one level of skill

if I input
AAAGUUUCCCGGUUAAGCGCUAAAA or any other random string of bases

then it folds to some natural shape

perhaps that shape is a line - but if it's not a simple line then the shape must have a notation.

But I think I'd struggle to create that notation - so why not allow someone to 'grab' the shape notation from the natural shape that they think looks interesting.

then they can mess about with bonds until they get something that looks challenging, grab the shape notation, and you know there is already a solution (and you can grab the existing sequence) So then you can paste that all into a challenge and upload it - by just typing in random bases into a 80 character long sequence. If it doesn't form 1 or more pairs ignore it and otherwise you could publish all combinations of 80 bases as all the possible lab puzzles.

ok 4^80 (+ 4^79 + 4^78 etc) is a lot but many of them will be lines (no bonds) and can be immediately discounted

and then only some of them will have distinct shape notations - so any duplicate shape notations can be discarded

that then produces 'every' possible puzzle that can be completed as a lab candidate.

Edward :)
Photo of Edward Lane

Edward Lane

  • 139 Posts
  • 8 Reply Likes

Posted 8 years ago

  • 1
Photo of Edward Lane

Edward Lane

  • 139 Posts
  • 8 Reply Likes
ok just did the sums, it's a big bunch of number crunching as that's 1.4 x 10^48

so not quick to generate 'all possible puzzles' but the copy the shape notation from the natural form still seems like a decent idea to make it easier/quicker to build new puzzles.