An analysis of JR_TheoAssSpin_Sub00102

  • 1
  • Article
  • Updated 7 months ago
Here is the design:


Here is the analysis:

Here is the discussion:

The switch was designed in Nupack.

The requirements I think about in addition to the puzzle requirements are:

1.)    I would like to see each aptamer break apart as much as possible between off and on states and

2.)    Minimize the distance NTs have to travel between the on and off states to create the switch.

You can break the switch sequence into 5 parts. A top stem, the spinach aptamer, a folding area ( for lack of better terminology ), the molecule aptamer and a closing stem.

I control the switch from state 1 to 2 by manipulating the folding are.  The folding area can be either passive or aggressive.  An aggressive folding area either creates a slide between NTs or targets a portion of either aptamer.  

Some of the more positive attributes to the design are that:

1.)    State energies are very close, switch doesn’t have to have some sort of energy boost to move from state 1 configuration the state 2.

2.)    Arc plot X factor levels are balanced and high giving the same probability for closure on either side of the spinach aptamer.

3.)    One side of the spinach aptamer binds to the molecule aptamer in the off state.

4.)    Valid in all 3 engines,  (  do not know if this is important ). 

5.)    Both aptamers are completely broken apart in the off state

6.)    The distance NTs have to travel to its associated pair in the next state is acceptably minimized.

This particular design uses a passive approach, which means the folding area plays a subordinate role in the sequence.  The folding  area is made up of predominately AUs and only bind in one of the states.    

So where does the sequence get its initial momentum to switch between off and on?

I would say it is the initial stem built with strong GCs and immediately connected to the spinach aptamer that does the trick.

 The sequence of events might be something like: The folding of the strong initial stem pulls the half of the spinach aptamer away from its attachment to the molecule aptamer to allow the molecule to close it’s aptamer.




Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes

Posted 7 months ago

  • 1
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
JR, thanks! Can you remind me again what the  Arc plot X factor levels  are? (Or just point me to the link explaining them).
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
They are from:   Arc-Plot Tool  ( http://35.185.225.39:8888/arcplot.html ) by  jandersonlee and Eli.
From stats below:
 


C4:G82   | S1:    0.01 kcal   98.98% | S2:    0.00 kcal   99.61% | static Spinach
A23:U68  | S1:    3.04 kcal    0.64% | S2:    0.22 kcal   69.85% | ON  108.86x Spinach
G28:C58  | S1:    2.96 kcal    0.73% | S2:    0.14 kcal   79.50% | ON  109.14x Theophylline
G35:C48  | S1:    0.01 kcal   98.17% | S2:    0.00 kcal   99.62% | static Theophylline

         
AGGCGUUGAGUAGAGUGUGAGCACACGGAUACCAGUGUCGAAAGACACCCUUGGCAGCCGAUAAAUGUGAAGGACGGGUCCGCCA     0.30
.((((.((.(((..((((....))))...)))))(((((....)))))((((.(((.........))).)))).......)))).   -26.10
.((((..((.....((.(...(((((((...((((((((....)))))...)))...))).....))))..).))...)))))).   -26.40 



Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
A bulge in an unusual place


First I wish to highlight how many of the bases that are pairing between the two aptamers (green lines) when the switch is in the OFF state. 

               

Second the bend in JR's design in state 2, between the two molecules that are being bound, has got me wondering. (especially since this design is the overall best from the lightning round).

               

The bulge (base 61-65) is rather unusual when it comes to elements between aptamer gate stems in a same state puzzle. Typically there will be loops inbetween such stems. 

This bulge has made me wonder if coaxial stacking can take place across bulges and not just for adjacent stacks in multiloops. This paper says yes to that: 

"Helical elements separated by bulges frequently undergo transitions between unstacked and coaxially stacked conformations during the folding and function of noncoding RNAs."

(Increasing the length of poly-pyrimidine bulges broadens RNA conformational ensembles with minimal impact on stacking energetics

Also I have read that a bulge can act as an attractor for metal ions - if the sequence is right - which again can add extra stabilization. Especially adenine-rich bulges should be good for that. 

"Distortions of the RNA backbone at bulge sites can force negatively charged phosphate groups into close proximity, thus creating preferred binding pockets for metal ions [25]. By binding to bulge regions, metal cations attenuate negative charge density and stabilize sharp turns of the RNA backbone. The adenine-rich bulge, a structural hallmark motif of the P5 stem in the core of the P4–P6 domain of group I introns, adopts a narrow corkscrew turn in which the phosphate groups are turned inside the loop and coordinate two Mg2+ ions, while the bases are oriented towards the outside 1617 (Figure 2a). This ‘inside-out’ geometry of the adenine-rich bulge allows for the formation of a network of hydrogen-bonding interactions involving the splayed-out bases, which anchor the P5 stem into the P4 subdomain. The prominent role of Mg2+ ions in the stabilization of this adenine-rich bulge has led to the suggestion that RNA folds around a ‘metal ion core’ [17], in analogy to the hydrophobic core of proteins."

"The quasi-continuous arrangement of duplex RNA fragments in crystals strongly favours coaxial stacking of the stems that flank the bulge sites."

See the section Bulge stabilization by metal ions in the paper RNA bulges as architectural and recognition motifs.


Proposed experiments

I would really like to see what would happen with the switching ability if: 

  • The length of the bulge was increased
  • The length of the bulge was decreased
  • The sequence of the bulge was mutated
  • The bulge was made into different size loops
  • The bulge was inverted
I think these tests may help answer the question about if the bulge is playing a special role.

Basically I hope for a second round of this lab sometime in the future. :)
(Edited)