Coder Required: Secondary Structure Classification of RNA Switches

  • 3
  • Idea
  • Updated 2 years ago
This post is a call for a coder in the Eterna community to take part in an initiative to classify the predicted secondary structures of the tens of thousands of RNA switches that have been designed by players for the Chip-Riboswitch labs. The rules for the algorithm are detailed in this document:

https://docs.google.com/document/d/1e...

Some minor notes about the algorithm include that it may be necessary to code multiple iterations of the algorithm until a set of instructions for classifying any structure is found. Also, if players are interested in contributing to the ground rules for the algorithm, that should be possible as well.

Any players interested in this may comment here or send a private message to me (Brourd) in game.
Photo of Brourd

Brourd

  • 437 Posts
  • 79 Reply Likes

Posted 2 years ago

  • 3
Photo of eternacac

eternacac

  • 274 Posts
  • 19 Reply Likes
Hmmm, this guy has a grammar for what appears to be the topology your algo uses : http://www.rnaparse.com/about.html

Excerpt below:

Projected to a flat topology map (below) the crossing properties of each connection becomes more clear: a and c connect across b and so forth. The second set of letters represents how the points of connection are rewritten to represent a point and its compliment (compliment denoted by the prime strike.) Thus: a connects to a' across b, c to c' across b' and d...


Projected to a flat topology map (below) the crossing properties of each connection becomes more clear: a and c connect across b and so forth. The second set of letters represents how the points of connection are rewritten to represent a point and its compliment (compliment denoted by the prime strike.) Thus: a connects to a' across b, c to c' across b' and d...




If we continue adding amino acids to our toy protein to the point in which the chain may fold back upon the helix and interact with it the topology becomes more complex with an increase of crossing interactions. None the less, the topology is described in the same way.



or [a b a' c b' d e c' f g e' g f' h g' h' g' d']

We can begin to see a few very long distant amino acid interactions that cross other interactions.

To grammatically describe such a shape as above turns out to be remarkably easy if we rewrite each connection point as having a compliment point; a-a', b-b',c-c'...

where points a = a,

b = b,
c = a',
d = c',
e = b', ...

The Algorithm for defining the protein shape describes just two things, a point and its compliment and the placement of each point and its compliment:


To describe the second, more complex helix:


let a be the compliment of a',
let b be the compliment of b',
let c be the compliment of c',
let d be the compliment of d',
let e be the compliment of e',
let f be the compliment of f',
let g be the compliment of g',
let h be the compliment of h'

such that a b a 'c b' d e c' f g e' g f' h g' h' g' d'



A very simple grammar for the second helix is expressed in a single predicate: where “rho <=” represents an AFFIX operator that builds a complement from its corresponding point.

my_predicate::=


$A("")(( 'a'   rho (A<="c" A))) //accept the empty string. Make “a” the compliment of “c”

//if we wanted to add amino acids to skip, its done here as a regular expression.

$B("")(( 'b'   rho (B<="e" B)))

A //”A” becomes the compliment of “a”, “c”

$C("")(( 'd'   rho (C<="h" C)))

B

$D("")(( 'f'   rho (D<="r" D)))

$E("")(( 'g'   rho (E<="k" E)))

C

$F("")(( 'i'   rho (F<="m" F)))

$G("")(( 'j'   rho (G<="q" G)))

E

$H("")(( 'l'   rho (H<="o" H)))

F

$I("")(( 'n'   rho (I<="p" I)))

H
I
G
D

//end




Contact   jlynn@acsalaska.net
If you wish further information, source code, or built .exe's, contact me.
Copywrite 2012 all rights reserved save by permission by James F. Lynn
(Edited)
Photo of Meechl

Meechl

  • 81 Posts
  • 27 Reply Likes
Sounds like fun! I am willing to try to do this. However, I haven't been involved with Eterna for a while, so I am pretty out of the loop when it comes to labs.

The part of this which initially sounds most challenging/tedious to me is getting all the sequences and structures. If the lab results have been published (like with R101), I can get the sequences from those. Know of a way to get the structures (dot bracket notation)? If not, I'll start with a handful of designs and see if I can code something that can classify those.  
Photo of eternacac

eternacac

  • 274 Posts
  • 19 Reply Likes
This is borrowed from  a script by jandersonlee, modified to just get the dot-bracket structure from a puzzle or lab id.
Script file for
Secondary Structure dot-bracket notation

// fetch and dump the SHAPE data for a lab solution to Result Console
// eg id=2712700 soln=2345053 // Cloud lab 19, Rfam Gangnam Style
//
//var id = 2866690;
//var soln = 2874080;

function get_lab_or_puzzle( id )
{
  var params = {
    type: "puzzle",
    nid: id
  };
  res = AjaxManager.querySync("GET", Application.GET_URI, params);
  return res.data['puzzle'];
}

function getAllSolutions( lab_id )
{
  var params = {
    type: "solutions",
    puznid: lab_id
  };
  var res = AjaxManager.querySync("GET", Application.GET_URI, params); 
  if (!res || (res.length == 0)) {
    return ("No results returned.  Is the lab_id " + lab_id + " correct?.")
  }
  var solutions = res["data"]["solutions"];
  return solutions;
}
 
function strVal(v)
{
    var os = '';
    if (typeof v == 'string') { os = '"' + v + '"'; }
    else if (v != null) { os = String(v); }
    else os = 'null';
    return os;
}
function dumpVal(name,v)
{
  outln("  " + name + ": " + strVal(v));
}
function dumpObject(o)
{
  for (var j in o) { dumpVal(j, o[j]); }
  return o;
}


function Lab(lab_id) {
   // Get all the solutions for the specified lab_id
  this.id = lab_id;
  this.data = get_lab_or_puzzle ( lab_id );
  if (this.data.usetails)
    this.solutions = getAllSolutions(lab_id);
  else
    this.solutions = [];
}
Lab.prototype.eachSoln = function (fn) {
    var res = [];
    for (var i=0; i<this.solutions.length; i++) {
      res.push(fn(this.solutions[i]));
    }
    return res;
  }
Lab.prototype.soln = function ( solutionId )
  {
    for (var i = 0; i < this.solutions.length; i++) {
      if (this.solutions[i].id == solutionId) {
        return this.solutions[i];
      }
    }
    return null;
  }

var lab = new Lab( id );
//dumpObject(lab.data);
//outln('');
var candidate = lab.soln(soln);
//dumpObject(lab.soln(soln));

var ss = lab.data.secstruct;

dumpVal("secstruct", ss);
dumpVal("secstruct.length", ss.length);

return lab.soln(soln);
Photo of eternacac

eternacac

  • 274 Posts
  • 19 Reply Likes
found this code from ElNando888 which might be helpful:

function stack_length(p, idx, ofs) {
  var len = 1;
 
  var next = idx;
  while (true) {
    next = next + ofs;
    if (typeof p[next] == 'undefined') break;
    if (p[next] - p[idx] != idx - next) break;
    len++;
  }
 
  return len;
}

var applet = document.getElementById('maingame');
if (applet==null) return null;

var seqs = [
  // 'UAUUCUUUGUUGUGAACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGAAUCAGGUGAUCCUGA','AAUUCUUUGUUGUGAACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGAAUCAGGUGAUCCUGA','AAUUCUUUGUUGUGAACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGAAACAGGUGAUCCUGU','AAUUCUUUGUUGUGAACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGAAUCAGGUGGUCCUGA','AAUUCUUUGUUGUGGACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGAAUCAGGUGAUCCUGA','AAUUCUUUGUUGUGAACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGUAUCAGGUGAUCCUGA','AAUUCUUUGUUGUGAACAAUGGUCUCAAAGUCUCAGCACAUGAGGAUCACCCAUGUGAUGAGGGAACUGAGUCAGGUGAUCCUGA','AAUGAGGGAAAUACAUGAGGAUCACCCAUGUUAGGAUCACCCAUGUGACUGAAGCGAUUUACAAGGCUUGUCUUUAUUGAAGGGU','AAUGAGGGAAAUACAUGAGGAUCACCCAUGUUAGGAUCACCCAUGUGACUGAAGCGAUUUACAAGGCUUGUCUUUAUUGUUGGGU','AGUGAGGGAACUACACAUGAGGAUCACCCAUGUGCUUCACGUAUGUGUCUGAUGGGCUCUAAGAGCCCAGACUUUAUUGUGUGGU','CGUGAGGGAACUACACAUGAGGAUCACCCAUGUGCUUCACGUAUGUGUCUGAUGGGCUCUAAGAGCCCAGACUUUAUUGUGUGGU','GUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGGUACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGGAUCUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGUAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGCAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGAAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUUGGAUCCUCAGCC','GAGGGAACUGCUUGGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','GAGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUGUUCUUUAUUGUCGGAUCCUCAGCC','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUUAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUUCUCAAU','AACUAUGGAUCCUAAACUUAUUCUUUAUUGUGGUAACAUGAGGAUCACCCAUGUAACUAAGCAGAUCCUAGAGGGAACUGCUUAG','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','UAGGGUGAUAAAACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUACACAAGCAGUAUGGGUAAGUGGGAACUGCUUAG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','GAGGGAACUGCUUAGAUGAGGAUGUUCCUUUGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGACCAUCCUCAAU','AUCCUCAACAACUUAUUCUUUAUUGUGGUAACAUGAGGAUCACCCAUGUCAUCCUAAGCAGAAAUAAAUAAAGGGAACUGCUUAG','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGACCAUCCUCAAU','UAGGGUGACAAAACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUACACAAGCAGUAUGGGUAAGAGGGAACUGCUUAG','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCUUCCUCAAU','UAGGGUGAUAAAACUUAUUCUUUAUUGUGGUUACAUGAGGAUCACCCAUGUACACAAGCAGUAUGGGUAAGAGGGAACUGCUUAG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCUUCCUCAAU','UAGGGUGAUAAAACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUACACAAGCAGUAUGGGUUAGAGGGAACUGCUUAG','AACUAUGGAUCCUAAACUUAUUCUUUAUUGUGCUAACAUGAGGAUCACCCAUGUAACAAAGCAGAUCCUAGAGGGAACUGCUUAG','UAGGGUGAUAAUACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUACACAAGCAGUAUGGGUAAGAGGGAACUGCUUAG','AGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUAG','CGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUAG','AACUAUGGAUCCUAAGCUUAUUCUUUAUUGUGGUAACAUGAGGAUCACCCAUGUAACAAAGCAGAUCCUAGAGGGAACUGCUUAG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUAG','AAUGAGGGAAAUGCUUAUACAUGAGGAUCACCCAUGUGUAAUAAGGGUAAUACGAUGAGCUUAUUCUUUAUUGUAGGGAAAUAAA','AAUGAGGGAAUUGCUUAUACAUGAGGAUCACCCAUGUGUAAUAAGGGUAAUACGAUGAGCUUAUUCUUUAUUGUAGGGAAAUAAA','AAUGAGGGAAUUGCUUAUACAUGAGGAUCACCCAUGUUUAACUAGGGUAAUACGAUUAGCUUAUUCUUUAUUGUAGGGAAAUAGA','AAUGAGGGAAUUGCUUAUACAUGAGGAUCACCCAUGUUUAACUAGGGUAUUACGAUUAGCUUAUUCUUUAUUGUAGGGAAAUAGA','AAUGAGGGAAUUGCUUAUACAUGAGGAUCACCCAUGUUUAACUAGGGUACUACGAUUAGCUUAUUCUUUAUUGUAGGGAACUAGA','AAUGAGGGAAUUGCUUAUACAUGAGGAUCACCCAUGUUUCACAAGGUUCCUACUAUAAGCUUAUUCUUUAUUGUAGGGAACUAGA','GUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUGAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCUUCCUCAAC','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUGAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAG','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAA','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAC','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAG','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAGUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','UUAGUGAGGGAACUACUUAUUAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','CUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAGU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCGCUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUUAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCGUCCUCUAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCGCUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCGCUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCGUUCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAGUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAUU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGGU','AUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCGGCCUCAAU','AUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGCAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGUCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUUCUCAAU','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','UUAGUGAGGGAACUACAUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AGAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUUAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUUCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGUCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGACCAUCCUCAUU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCGCUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCGUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAACUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUUCUCAAU','UUAGUGAGGGAGCUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','UUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGCAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUUAAU','AUAGUGAGGGAACUACUUAUGAUGGGUCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUUAAU','AUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','UUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','AUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUUCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGUCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','UUAGUGAGGGAACGACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCGUCCUUAAU','AUAGUGAGGGAACUACUUAUGAUGGGUCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUUAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCUAUUCUCAAU','AUAGUGAGGGAACUUCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','UUAGUGAGGGAACUACUUAUGCUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','UAGGGUGAUAAAACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUACAAAAGCAGUAUGGGUAAGUGGGAACUGCUUAG','UAGGGUGAUAAAACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUUCACAAGCAGUAUGGGUAAGUGGGAACUGCUUAG','UAGGGUGAUAAAACUUAUUCUUUAUUGUGGAUACAUGAGGAUCACCCAUGUACAGAAGCAGUAUGGGUAAGUGGGAACUGCUUAG','UUAGUGAGGGAACUACUUAUGGUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUGUUGUGGGCCAUUCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAUAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUUCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGACCAUCCUCAUU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUCAUUCUUUAUUGUGGGCCAUUCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAACUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGUCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUGUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGCAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUUAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCGCUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUUAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','UUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCGAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCGUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAACUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','AUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUUAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCUAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAACUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGCAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAUAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAUAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGAGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAGCCUCAAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCAAGCCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCAAUCCUCCAU','AUAGUGAGGGAACUACUUAUAAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCCAUCCUCCAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAGCCUCAAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGCUAUCCUCCAU','UUUACUUAUUCUUUAUUGUGGAUCUAGAUCCAAGUAUACAUGAGGAUCACCCAUGUUUUAAGUGAGGGAUCUGUUUAGGAUGUCC','UUUACUUAUUCUUUAUUGUGGAUCUAGAUCCAAGUAUACAUGAGGAUCACCCAUGUUUAUAGUGAGGGAUCUGUUUAGGAUGUCC','UUUACUUAUUCUUUAUUGUGGAUCUAGAUCCAAGUAUACAUGAGGAUCACCCAUGUUUUUAGUUAGGGAUCUGUUUAGGAUGUCC','AUAUAAUGAGGGUACAGCUAAUUUACAUGAGGAUCACCCAUGUUAUUAUCGAUGUGUAAAUAACUUAUUCUUUAUUGUGGUAUAU','AUUUUAUGAGGGUACAGCUAAUUUACAUGAGGAUCACCCAUGUUAUUUUCGAUGUGUAAAUAUCUUAUUCUUUAUUGUGGUAUAU','AUUUUAUGAGGGUACAGCAAAUUUACAUGAGGAUCACCCAUGUUACAAUCUAUGAGUAAAUAUCUUAUUCUUUAUUGUGGUAUAU','AAUAUAUGAGGAUACAGCAAAUUUACAUGAGGAUCACCCAUGUUAUAAUCUAUGAGUAAAUAUCUUAUUCUUUCUUGUGGUAUAU','AAUAUAUGAGGGAACAGCUAGUUUACAUGAGGAUCACCCAUGUUUUAAUCUAUAAGUAAAUAACUUAUUCUUUCUUGUGGUUUAU','AGGAUUAGAGGGAUUAGCUUAGUUACAUGAGGAUCACCCAUGUUUUUUUUGAUAAAAGUGUAUUUUAUUCUUUCUUGUGGUAAAU','AUACCAUGAGGGAAUUGCAUUGAGUAAUAUUUUAUGUCAUACAUGAGGAUCACCCAUGUUUUAAUAGUUCUUUAUUGUGGUUUAU','AUACCAUGAGGGAAUUGCAUUGAGUAAUAUUUUAUGUCAUACAUGAGGAUCACCCAUGUUUUAAUAAUUCUUUAUUGUGGUUUAU','GGAGAAACUAUUCUUUAUUGUGGAUUUACCUCUAACAUGAGGAUCACCCAUGUAACAUGAUCGUUGAGGGAACUGUUUCCGGAGG','AGACAAUGUUGGAACUGCUGUAAACAUGAGGAUCACCCAUGUAAACAUGGUAAUUCUACUGACUUAUUCUUUAUUGUGGGACAUC','AGACAAUGUUGGAACUGCUGUAAACAUGAGGAUCACCCAUGUAAACAUGGUAAUUCUACUGACUUAUUCUUUAUUGUGUGACAUC','AGACAAUGUUGGAACUGCUCUGAACAUGAGGAUCACCCAUGUAAUUUGGGUAAAUGUUGUUACUUAUUCUUUAUUGUGUGACAUC','AGUCAAUGUUGGAACUGCUUGGAACAUGAGGAUCACCCAUGUAUCAUAGGAACAGGGUUUUACUUAUUCUUUAUUGUGUGGCAUC','AUUCAAUGGUGGAACUGCUUUGUACAUGAGGAUCACCCAUGUAAUAUAGGUGAAGGAUAUUAAUUAUUCUUUAUUGUGUGGCAUC','AUUCAAUGGUGGAACUGCUUUGAACAUGAGGAUCACCCAUGUAAUAUGGGAGUAGGUAGCUUUUUAUUCUUUCUUGUGUGGCAUC','GGCCAAAGAGGGAACUGCUAUCAUGUAACAUGAGGAUCACCCAUGUCUAGUUUCUAAUAGAAUAAAUUCUUUAUUGUGAGGUAGC','UCUUAUCUUAUUCUUUAUUGUACAUCUUAAACAUGAGGAUCACCCAUGUGAACAAUGGCCGAGUUGAGGGAACUGUUUGGAAUGC','UCUUAUCUUAUUCUUUAUUGUUCAUUAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUAAUGGGAACUGUUUGGAAUGC','UCUUAUCUUAUUCUUUAUUGAUCAUUAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUUUUGGGAACUGUUUGGAAUGC','ACUUAUCUUAUUCUUUAUUGAGCAUUAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUUUUGGGAACUGUUUGGAAUGC','ACUUAUCUUAUUCUUUAUUGAGCAUUAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUUUUGGGAACUGUUUGGUAUGC','ACUUAUCUUAUUCUUUAUUGAGCAUUAUAUACAUGAGGAUCACCCAUGUUGACAUGGUCCGAGUUUAGGGAACUGUUUGGUAUGA','AAUUAUCUUAUUCUUUAUUGAGGGUUUCAAACAUGAGGAUCACCCAUGUUUACAUGGACCUUGUUUUGGGAACUGUUGGGUAUGU','AAUUAUCUUAUUCUUUAUUGAGGGUUUCAAACAUGAGGAUCACCCAUGUUAACAUGGACCUUGUUUUGGGAACUGUUGGGUAUGU','UACAUGGGUUAAAUGAGGGAGCUGCUUCACAUGAGGAUCACCCAUGUAGACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','GGAUCCUCACCAUGAGGGAACUGCUUUACAUGAGGAUCACCCAUGUCGACAGAAGAGAAAGGUGAGGAUUAUUCUUUGUUGUGGC','UAAUGAGGGAACUGCUUUAUCGGUUCCUCAGUGGUAUAACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGGGACUGAUCUUCC','UCAUGGGUGAUGUGAGGGAACUGCUUAACAUGAGGAUCACCCAUGUACAGUUGCUCAGGGCUCCCAUGAUUCUUUAUUGUGGGCG','CGAGGGAACUGCUUAGGUCCCGUGGGCGGUUCAGAAACACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGUACGGGUGAUUC','CGUGGGUGCGUUAUUCUUUAUUGUGGACAUGAGGAUCACCCAUGUCAAUAGUUCCUCAUCUCACCCAAUGAGGGAACUGCUUAGC','UUACUUCAUGUUAUUCUUUAUUGUGGAACAUGAGGAUCACCCAUGUACAAUUAGCCCUCUUCAUGAAGAUGAGGGAACUGCUUCC','UAUGGGUGAUUGAGGGAACUGCUUAGACAUGAGGAUCACCCAUGUAGCAGUCAGUAAAGGGUCAUCCAUUCUUUAUUGUGGGCUG','UUGAGGGAACUGCUUAAGAAGAUCUCGCAGCCUCAGUUACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGGAAAUCUUCAAAU','AUGAGAUCCUCCAUGAGGGAACUGCUUACAUGAGGAUCACCCAUGUGAGCUCAUAAAGGAUAGGGAUCAUUCUUUAUUGUGGGCG','GAGGGAACUGCUUAGAAAUCAGCUAUCCCUCAGAAGAACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGGCGGGUGAUUUUAC','UGAGGGAACUGCUUAGAAUCAGGUUACCCUCAUAGCGACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGUACUGAUUCUGUCA','GUGAUCUUUUGAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUAUCACAGGUUCUUCAUUGACUAUGAGGGAACUGCUUAAGG','ACAUGGGUGAUGAGGGAAUUGCUUAGAACAUGAGGAUCACCCAUGUAAAAGCUCCAUCACUCUCAUGAAUUCUUUAUUGUGGGCA','CUUGAUCCUCAGAUGAGGGAACUGCUUACAUGAGGAUCACCCAUGUAAGAUGAACAAUAGAGGAUCCGAUUCUUUAUUGUGGGUU','GGGUGGUCCCUUGAGGGAACUGCUUAACAUGAGGAUCACCCAUGUUGAGGCAGCAAUGUAGGGACCCUAUUCUUUAUUGUGGUCA','GUGAUCCUCACUGAGGGAACUGCUUAGACAUGAGGAUCACCCAUGUAAAGCGCAAAGACGGAGGAUCACUUAUUCUUUAUUGUGG','GGAGGGAACUGCUUAGGACACCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGGAUGGGUGAUUG','GAGGUGAUCUAAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUCACAGAUCCCUCAUAUCACCUGAAUGAGGGAACUGCUUAU','GGGUGAUCCUGGAGGGAGCUGCUUAGACAUGAGGAUCACCCAUGUUAGCAGACAAUAUCAAGGAUCCAUUCUUUAUUGUGGGCUA','GAUUCUUUGUUGUGGGCGGUCACCACAAGGAGUUCUUAACAUGAGGAUCACCCAUGUGAUGAGGGAACUGCUUCUCGGUGAUCCC','UGAGGGAACUGCUUACAGGAUGAUUUCCCUCAAAGAAACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGUCAAUCCUCAUCU','UAAUGAGGGAACUGCUUCGAGGUUUCCCUCAUGUCGACACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGGACGCCUCGUGAU','ACGGUGAUAUAUAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUACAAGUGUUCCAGGUGUAUCACAAUGAGGGAACUGCUGA','GGAUUCUCGUAUAUUCUUUAUUGUGGGUACAUGAGGAUCACCCAUGUCACAAUGUUUCCUCAGAGAAUCUGAGGGAACUGCUUAA','CCUGGUGAUUCGUAUUCUUUAUUGUGGUACAUGAGGAUCACCCAUGUCAAUCAGUUUCCUCUGUCACCCGAGGGAACUGCUUAGU','CGUUGAUCCUUCAUGAGGGAACUGCUUACAUGAGGAUCACCCAUGUAGCAGUUAAAGGAUCCGAUCAGUUAUUCUUUAUUGUGCA','AAAUGAGGGAACUGCUCUUAGGAUCCCUCAUUAAAGUUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGGAUCCUCAUCGU','ACAAUGGUCCUAAAUGAGGGAACUGCUACAUGAGGAUCACCCAUGUUAUUCUACAAUAGGUGACCAUUUAUUCUUUAUUGUGGUA','AUGAGGGAACUGCUUAGUACUUGGGUCAGUUCGAAUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUUCAUGGGUACGUCG','GAGGGAACUGCUUAGGAGAUGGCGUUCCCUCAGAAACACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGCCAUCCUUAUAG','UAUUCUUUAUUGUGGAGAUCAAUCACAAUACUAUUUCACAUGAGGAUCACCCAUGUGAGGGAACUGCUUGGCAUUGAUCCUUAGG','UUUGAUCCUCAGAGGGAACUGCUUAGACAUGAGGAUCACCCAUGUCAAAGUCAUAGUAGGUUAUCCGUAUUCUUUAUUGUGGACA','UAUUCUUUAUUGUGGCCGGAUCCCAAUAAAGUCUCUGACAUGAGGAUCACCCAUGUAGUGAGGGAACUGCUUUUUGAUCCGUUUC','AUUCUUUAUUGUGGGUAAAUCACUAUAAGGCUCUUUGACAUGAGGAUCACCCAUGUGAUGAGGGAACUGCUUGGUGAUCCUUCUC','UAAUGAGGGAACUGCUUGUCAUGAGCCCUCAUUAGAUCACAUGAGGAUCACCCAUGUCUAUUCUUUAUUGUGGUCAUGAUUCUAA','GUGAUCUUCAAAAUGAGGGAACUGCUACAUGAGGAUCACCCAUGUUAGUUCACAAUGAUUGAGGGUGUUUAUUCUUUAUUGUGGA','GAAUGAGGGAACUGCUCGGAUCAGCUCCCUCAUAAGAGACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGGCUGGUGAUCUCA','ACUGAUCCUAGAUUCUUUAUUGUGGGCACAUGAGGAUCACCCAUGUACCGGUCACCCUCACUAGGAUAAAUGAGGGAACUGCUCA','AUGAGGGAACUGCUUGGUCACCUGGCAGUUCCUGAGAAACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGUGGGUGAUACCAA','AUAUUCUUUAUUGUGGAUCAUCCUCCACACAACGCCUUACAUGAGGAUCACCCAUGUUGAGGGAACUGCUUAGAGGGUGAUGAAA','AAUGAGGGAACUGCUAGAGGGUGUCAGUUCCUAAGAGACAUGAGGAUCACCCAUGUUUGUUCUUUAUUGUGCCAGAUCCUCUACA','AGAGGGAACUGCUUAGGUGGAUCCUAAGCAGUAUGAUAACAUGAGGAUCACCCAUGUAUAUUCUUUGUUGUGGUGGUGAUCCGUG','AUGAGGGAACUGCUUAUGAGGUGACGUUCCCAAAGAGACAUGAGGAUCACCCAUGUUAUUCUUUGUUGUGGCGGCCUCAUGGAGG','UAGUGGGUGAUCGAGGGAACUGCUUGGACAUGAGGAUCACCCAUGUCGCAGCAGAGACGGGAUCACACUUAUUCUUUAUUGUGCU','AUUCUUUAUUGUGGGAUCACCCGUAAAGAAUUUCAUUACAUGAGGAUCACCCAUGUCAAUGAGGGAACUGCUAUGUGGGUGUGCA','AAGUGAGGGAACUGCUUGUGGAUCUGCAGUUACUUAGGACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGGAAAGAUCCAGAA','AAUGAGGGAACUGCUGAAUCCGGGCCCUCAUUAGAGAACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGCGGGUGAUUCUAGU','AUGGGUGACGCAUGAGGGAACUGCUUCACAUGAGGAUCACCCAUGUAAGCACAUAAAGACUCUCACCCUAUUCUUUAUUGUGGUG','GGAGGUGAUCGAAUGAGGGAACUGCUUACAUGAGGAUCACCCAUGUACAGCGCAAAGACAGAUACCUCCUUAUUCUUUAUUGUGC','GACAGGGUGACUAAUGAGGGAACUGCUAACAUGAGGAUCACCCAUGUUAGUUUAAAGGAUGGUGACCAAUAUUCUUUAUUGUGGG','CGCGCCUCAACAAAUGAGGGAACUGCUACAUGAGGAUCACCCAUGUUGAGAUCCACAGAGCUGAGGCAUAUUCUUUAUUGUGGCA','AUUCUUUAUUGUGGGAAAGAUCUUACAAUGGCCUUUGACAUGAGGAUCACCCAUGUAAAUGAGGGAACUGCUGGUGGUCUUUGUU','AGGAUCCUCAGAAUUCUUUAUUGUGGGUACAUGAGGAUCACCCAUGUAUAAUACAGUUCCCGGUGAUCCAAUGAGGGAACUGCUA','ACUUCCUCGUGCUUAUUCUUUAUUGUGGACAUGAGGAUCACCCAUGUUAUAAAGUGUUCCCUCGAGGAUGAGGGAACUGCUUAGG','GAUGAGGGAAUUGCUUUUGGGUCCUCAAUUCAAGUAAGACAUGAGGAUCACCCAUGUGCUUAUUCUUUAUUGUGGAUCCUCACGU','UUUAUUCUUUGUUGUGCGUCACCACGAGGGAUUUCCAUACAUGAGGAUCACCCAUGUGGAGGGAGCUGCUUAGGUGGGUGACGUG','AGAGGGAACUGCUUAGAGAACCACAGUUCCUCAAGAACACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGGUGGUUCUGUCAC','AAAUGAGGGAACUGCUCUGAGCUUUCCUCAUUGUCAGAACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGAAUCCUCAGCUGC','AGCGGGUGGGCAUGAGGGAACUGUUUACAUGAGGAUCACCCAUGUCAAUAGCACAACUGAUCCCGUUUUAUUCUUUAUUGUGCUC','AGCGGGUGAUGCAUUCUUUAUUGUGGGCACAUGAGGAUCACCCAUGUAUCGGUAGUUCCGUGUCACCUCGAGGGAACUGCUUAGA','CGUGGGUGAUUAAUGAGGGAACUGCUACAUGAGGAUCACCCAUGUGGUUCCAGCGAAUAUUCACCGGUAUUCUUUGUUGUGGACA','UGAGGGAACUGCUUACGAUCUUCAGCGGUUAGAUUCAACAUGAGGAUCACCCAUGUGCUUAUUCUUUAUUGUAGAGAUCCUCAGG','AUUGGAUCCGGUAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUAACAAGUAGGUUCCCUCGGAUCAAUGAGGGAACUGCUUA','GGAGGGAACUGCUUAGUUAAGGAUCUCUCUGUGAAUAGACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGGUCCUCAUUGC','CAAUGAGGGAACUGCUUUUACAUGCUACCUCAAAGAAAACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGGAAUGUCCUCAUC','CCGGUCUUCAUUGAGGGAACUGCUUAGCACAUGAGGAUCACCCAUGUAAGAGGCGAUAGGGAGAGACCGUGUUCUUUAUUGUGGA','CAAUGGGUGCUAUGAGGGAACUGCUUACAUGAGGAUCACCCAUGUGCAGUACCGCAAUAGGAUCAUCAUUCUUUAUUGUGGGCGA','AUGAGGGAACUGCUUUGAAGCUCUUCCCUCGUUCGACACAUGAGGAUCACCCAUGUAUUCUUUAUUGUGGGCAGCUUCAUCGGGA','UGGUGAUCUUUGAGGGAACUGCUUAGACAUGAGGAUCACCCAUGUCGGCAGACAGGAAGAAAGAUCAUAUUCUUUAUUGUGGUCA','ACUUAUUCUUUAUUGUCGAUCACUCUAAGGAACUUCUGACAUGAGGAUCACCCAUGUGAAUGAGGGAACUGCUAUGGGUGAUCGU','AAAUGAGGGAACUGCUGAGAAAAGCGGUUCCUCGGAAUACAUGAGGAUCACCCAUGUUCUUAUUCUUUAUUGUCCUUUCUCAUUU','UAGUGGGUGUACUUAUUCUUUAUUGUGACAUGAGGAUCACCCAUGUCAAUUUCGUCCUCAUAUACCAAUGAGGGAACUGCUUAAG','AUCAUGGGUGAUGAGGGAACUGCUUAGCACAUGAGGAUCACCCAUGUAAGCAAAAGAAUACCCUCAUGUCUUAUUCUUUAUUGUC','CUUAUUCUUUAUUGUUCAUGAGGAGAGAAUGUAGCCCACAUGAGGAUCACCCAUGUUGAGGGAACUGCUUAGGAUCCUCAUGUCG','CCGUGAUCCAUGAUGAGGGAACUGCUUUACAUGAGGAUCACCCAUGUCAGUGCGCAAAUAGGGAUCGGUAUUCUUUAUUGUGGGA','GAUCCUUAUCGCUUAUUCUUUAUUGUUACAUGAGGAUCACCCAUGUAUAAAGGUAUUCCUCAUAAGGAUGAGGGAACUGUUUAUG','CGGGUGAUCAAGAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUCACAAGCAAGCAGGUUGAUCAUGAGGGAACUGCUUAGGU','GGUUCUUUAUUGUGGGUCGGAGAUCCUAAGAAGCCCUAACAUGAGGAUCACCCAUGUAAAUGAGGGAACUGCUCGAUCUUCGCGC','GAUUCUUUAUUGUGGGUGAGGAUCUGCAAUACGACUAGACAUGAGGAUCACCCAUGUUGAGGGAACUGCUUAGGGAUCCUCGGCA','GUGAGGGAACUGCUUAGAAAGACGAGGCAGGAUACAUAACAUGAGGAUCACCCAUGUCUAUUCUUUAUUGUGGGAUCUUUAGAAA','UGUCGGGUGGACUGUUCUUUAUUGUGGACAUGAGGAUCACCCAUGUCAUAGCAUAAUUCUCAACUCGGAUGAGGGAAUUGCUUAC','UAUUCUUUGUUGUGGAGGAUCAAAACAAAGACCUUCAACAUGAGGAUCACCCAUGUAAUGAGGGAACUGCUUUGUGAUCCUCAUU','UGAGGGAACUGCUUAAUCACCUCAGACAGUUUUAUACACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUCGGGUGAUCAUCGG','CUGGGUGAUUUUGAGGGAACUGCUUGGACAUGAGGAUCACCCAUGUUGCAGUAUGAUAAAGGGACCAAUUAUUCUUUAUUGUGAA','UGAGGGAACUGCUUAUAGAUCGAGCAGUUCCUAAAGAACAUGAGGAUCACCCAUGUAUUCUUUAUUGUGGGCUAGUGAUCUUGAA','UACGUGAUCCGUUUAUUCUUUAUUGUGACAUGAGGAUCACCCAUGUUAAUAAGUUCCUUGUGAUCUCGAAUGAGGGAACUGCUUG','CAAUGAGGGAACUGCUUACAUCAUUUCCCUCUUGAGACACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGGCUGGUGAUUCUG','UGGUGAUCCAUAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUUUCGCGGAACCUCAUCUCACCUAUGAGGGAACUGCUUUCA','CAAUGAGGGAACUGCUUCACCCGUCUCCCUCAUCUAUCACAUGAGGAUCACCCAUGUGCUUAUUCUUUAUUGUUCGGGUGAUUCG','UGAGGGAACUGCUUAGUCCAUAGUAUCGUUCCCAAGAGACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGGCGGGUGAUGUAG','UGAUUCUUAUGAAUGAGGGAACUGCUCACAUGAGGAUCACCCAUGUCGUUCUCACGGUGGUAAGAAUCUAUUCUUUAUUGUGGUU','GCGUGGGUGAUUGAGGGAACUGUUUAACAUGAGGAUCACCCAUGUCGGGCCUAAAUGAAUCACCUUUAUUCUUUAUUGUGGGCAG','CCUGUGGUCUGUAUUCUUUAUUGUGGGACAUGAGGAUCACCCAUGUACCACGGCCCUCAUGGACCAACAAUGAGGGAACUGCUAA','CCGCGGGUGAUCGAGGGAACUGCUUAGACAUGAGGAUCACCCAUGUUAAAUUCUCACAACAUCACCCUAUUCUUUAUUGUGGGCA','GUGAGGGAACUGCUUUCACCAUGGCAGUUCAUAAAGAACAUGAGGAUCACCCAUGUAUAUUCUUUAUUGUGGGUUGGGUGGCUAU','CAUGAGGGAACUGCUUGGGAUCAGGUUCCUUAGAAAGCACAUGAGGAUCACCCAUGUUCUUAUUCUUUAUUGUGAGGUGAUCCCA','GAUCCUCAUAAAAUGAGGGAACUGCUUACAUGAGGAUCACCCAUGUGUCCAGGAUAAAGAGAUGACGUAUUCUUUAUUGUGGGUC','AAUUCUUUGUUGUGGGUUCACCCACUAACAGGAUCUAUACAUGAGGAUCACCCAUGUGAUGAGGGAACUGCUUUGGGUGAUCACG','UAUGAGGGAACUGUUUGAGGGUGAACGUUCCCGAAGAAACAUGAGGAUCACCCAUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AUAACUUAUACUUUAUUGUGGACAAUAUAACAUGAGGAUCACCCAUGUGUCUUGGAUGUUUUUGUGGGAACUGUAUUAGAUAUAA','UUUACUUAUUCAUUAAUUUUGUGGGAAGGUGUAUCAGACUAAACAUGAGGAUCACCCAUGUAUGAGGGAAUGAACUGCUUUGAUC','UUUACUUAUUCUUUAAUAUUGUGGGAAGGUGUAUAGGUCUAAACAUGAGGAUCACCCAUGUAUGAGGGAAUGAACUGCUUUGAUC','UUUACUUAUUCUUUAAAAUUGUGGGAUGGUGUAUUGGUCUAAACAUGAGGAUCACCCAUGUAUGAGGGAAUAAACUGCUUUGAUC','UUUACUUAUUCUUUAAAAUUGUGGGAAGGUGUAUAGGUCUAAACAUGAGGAUCACCCAUGUAUGAGGGAAUAAACUGCUUUGAUC','UUAACUUAUUCUUUAAAAUUGUGGGAAGGUGUAUAGGUCUAAACAUGAGGAUCACCCAUGUAUGAGGGAAUAAACUGCUUAGAUC','AUAUGAGGGAAUUCUGCAUUGAUUUUAACGGAAUGGUAAGCUUACAUGAGGAUCACCCAUGUUAUGUAUUCUUUAAUUGUGGGAA','AUAUGAGGGAAUUCUGCAUUGAUUUUAACGGAAUGGUAAGCUUACAUGAGGAUCACCCAUGUUAUAUAUUCUUUAAUUGUGGGAA','CAAUGAGGGAACUGUGUUUUUAGUGAAAUAGAUCCAUUACAUGAGGAUCACCCAUGUUUGUUACUUGUUCUUGAUUGUGUAUAUC','CAAUGAGGGAACUGAGUUUUUAGUGAAAUAGAUCCAUUACAUGAGGAUCACCCAUGUUUGUUACUUGUUCUUGAUUGUGUAUAUC','CAAUGAGGGAACUGAGUUUUUAGUAAAAUAGAUCCAUUACAUGAGGAUCACCCAUGUUUGUUUCUUGUUCUUGAUUGUGUAUAUC','CCAUGAGGGAACUGAGUUUUUAGUUAAAUCGAUCCAUUACAUGAGGAUCACCCAUGUUUGUUUCUUGUUCUUGAUUGUGUAUAUC','AUAUGAGGGAACUGAGUAUAUUCAUUAGGUUGGUGUUCUUAAACAUGAGGAUCACCCAUGUAUAUUGUUCUUGAUUGUGGAUAUC','AAAUGAGGGAACUGAGUAUAUUCAUUAGUAUCACCCUUGUAACCAGACAUGAGGAUCACCCAUGUUGUUCUUAAUUGUGGAUAUC','AAAUGAGGGAACUGAGUAUAUUCAUGAGUAUCACCCUUGUAACCAGACAUGAGGAUCACCCAUGUUGUUCUUAAUUGUGGAUAUC','AAAUGAGGGAUAAAUGCUUAUGUUACAUGAGGAUCACCCAUGUUUGGUGUUCGAGUAGACUUUGUUAUUCUUUAUUGUUGGGAUC','AAAUGAGGGAUAAAUGCUUAUGUUACAUGAGGAUCACCCAUGUUUGGUGUUCGAGUAGUCUUUGUUAUUCUUUAUUGUUGGGAUC','CGUAAGAGGGAACUUCUUUGUACUUUCAUAGCUCCCAUGUAUACAUGAGGAUCACCCAUGUUACUAUUCUUUAUUGUGGUAGAGU','CGUAAGAGGGAACUGCUUAGUACUUUCAUAGCUCCCAUGUAUACAUGAGGAUCACCCAUGUUACUAUUCUUUAUUGUGGUAGAGU','UCUCACUACUUAUUCUUUAUUGUUUGCGACUUGAGGAUCACCCAUGUAUACAUGAGGAUCACCCAUGUAGGGAACAGCUUAAGGA','UCUCACUACUUAUUCUAUAUUGUUUUCGACUUGAGGAUCACCCAUGUAUACAUGAGGAUCACCCAUGUAGGGAUCUGCUUAGGGU','CCACACCACUUAUUCUUUAUUGUUUUCGACUUGAGGAUCACCCAUGUAUACAUGAGGAUCACCCAUGUAGGGAUCUGCUUAGGGU','AUUAUGAGGGAACUGUUUAUCUGAUCUGGAUAUACAUGAGGAUCACCCAUGUUGUAGACUUGUUCUUUAUUGAGUGUGGAAAUUA','AUUAUGAGGGAACUGUUUAUCUGAUCUGGAUAUACAUGAGGAUCACCCAUGUUGUAGACUUGUUCUUUAUUGUGUGUGGAAAUUA','UUUAUGAGGGAACUGUUUAUCUGAUCUGGAUUUACAUGAGGAUCACCCAUGUUGUAGACUUGUUCUUUAUUGUGUGUGGAAAUUA','UCAAUGAGGGAACUGUGUAUCUUAUUUUGAUCUAGAACAUGAGGAUCACCCAUGUAGACUAGUUCUUUAUUGUGUGUGGAAAUUA','ACAAUGAGGGAACUGUGUAUCUUAUUUUGAUCUAGAACAUGAGGAUCACCCAUGUAGACUUGUUCUUUAUUGUGUGUGGAAAUUA','UGUCAUAUUCAUUAUUGUGGAUUUAAGUUGAUCCAUUGACAUGAGGAUCACCCAUGUAGUUAAAGAGGGAUGUACUGCUUGAAUA','UGUCUUAUUCAUUAUUGUGGAUUUAAGUUGAUCCAUAAACAUGAGGAUCACCCAUGUAGUAAAAGAGGGAUGUACGGCUAGAAUA','UGUCUUAUUCAUUAUUGUGGAUUUAAGUUAGUUGAUCCAUAACAUGAGGAUCACCCAUGUAAAAGAGGGAUGUACUGCUAGAAUA','UGUCUUAUUCUUUAUUGUGGUAAUUAGUUAGUUGAUCCAUAACAUGAGGAUCACCCAUGUAAAAGAGGGAUGUACUGCUAGAAUA','UGUCUUAUUCUUUAUUGUGGUAAUUAAUUAGUUGAUCCAUAACAUGAGGAUCACCCAUGUAAAAGAGGGAUGUACUGCUAGAAUA','AGUCUUAUUCUUUAUUGUGGGAAUUAAUUAGUAGAUCCAUAACAUGAGGAUCACCCAUGUAAAAGAGGGAAGUACUGCUAGAAUA','AUACUUAUUCUUUAUUGUGGGAAUUAAUUAGUAGAUCCAUAACAUGAGGAUCACCCAUGUAAAUGAGGGAAUUACUGCUAGAAUA','AAUGAGGGACCCGCUUAGAAUAAAUAAACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUAAAACUUAUUCUUUAUUGUGGGAU','AAUGAGGGCCCUGCUUAGAAUAAAUAAACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUAAAACUUAUUCUUUAUUGUGGGAU','UAUUCAUUGUUGUGGAUUCUCACUCUACUCAUGUAACAUGAGGAUCACCCAUGUAAAGAUGAGUGUACUGCUUAGGUUUAUCAGG','UAUUCAUUGUUGUGGAUUCUCACUCUAAACAAAUGUAUACAUGAGGAUCACCCAUGUGAUGAGUGAACUGCUUAGGUUUAUCUGG','AUUGGGAACUGAUUAGAAUCAGGUUACCCUCAAUACAUGAGGAUCACCCAUGUUGUUUAUUCUUUAUUGAGUUCUGUUUCUGUCU','AGAGGGAACUGAUUAGAAUCAGGUUACCCUCUUAGCGACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGUACUGUUUCUGUCU','AUACUUUAUUGUGGGAUCACCUUUUUUGUCUCAUGUAACAUGAGGAUCACCCAUGUAAUUGUUGGAACUGCUUAGUGGAAUUGUA','AUACUUUAUUGUGGGAUCACCUUUAUUGUCUCAUGUAACAUGAGGAUCACCCAUGUAAUUGUUGGAACUGCUUAGUGGAAUUGUA','AUACUUUAUUGUGGGAUCACCUUUAAUGUCUCAUGUAACAUGAGGAUCACCCAUGUAAUUGUUGGAACUGCUUAGUGGAAUUGUA','UUUCUUUAUUGUGGGAUCACCUUUAAUGUCUCAUGUAACAUGAGGAUCACCCAUGUAAUUGUUGGAACUGCUUAGUGGAAUUGUA','GAUGAGGGAAAUGCUAGAGGGUUUCAGUUCCUAAGAUACAUGAGGAUCACCCAUGUUUGUUCUUUUUUGUGCCAUGUCCACUACA','GAUGAGGGAACUGCUAGAGGGUUUCAGUUCCUAAGAUACAUGAGGAUCACCCAUGUUUGUUCUUUUUUGUGCCAUGUCCACUACA','AAUGAGGGAACUGCUAGAGGGUUUCAGUUCCUAAGAUACAUGAGGAUCACCCAUGUUUGUUCUUUUUUGUGCCAUAUCCACUACA','AAAUGAGGGAACUGCGCUUUGCUUUCCUAAAUGACAGUACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGAAUCGUGAGAUGC','AAAUGAGGGAACUGCGCUUUGCUUUCCUAAAUGACAGUACAUGAGGAUCACCCAUGUUAUUCUUUAUUGUGGAAUCCUGAGAUGC','AAAUGAGGGAACUGCUCUGAGCUUUCCUCAUUGUCAGUACAUGAGGAUCACCCAUGUUUUUCUUUAUUGUGGAAUCCUGAGAUGC','AUGAGGGAACUGCUUAGUACUUGGGUCAGUUCGAAUUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUUCUUGGGUUCGUCA','UGAGGGUACUGCUUAGGAGAACGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUAUUGUGUGUGUGUAAUGU','AGAGGGUACUGCUUAGGAAAACGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUAUUGUGUGUGUGUAAUAU','UUAGGGUACUGCUUAGGAACCCGGUGAGCAGUAUUACAUGAGGAUCACCCAUGUUGACUUAUUCUAUAUUGUGGAUGGGUGAUUU','GGAGGGUACUGCUUAGGAUCCCGGUGAGCAGUAUAACAUGAGGAUCACCCAUGUUGACUUAUUCUAUAUUGUGGAUGGGUGAUUU','GGAGGGUACUGCUUAGGAUACCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUAUAUUGUGGAUGGGUGAUUU','GGAGGGAACUGCUUAGGAUACCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGGAUGGGUGAAUG','UUAGGGAACUGCUUACUGGUUGAUUUCCCUCUAAGAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGUCAAUCCUAAUCU','AUGAGGGAACAGCUUAUGAUGUGACGUUCCCAAAGUUACAUGAGGAUCACCCAUGUUAUUCUUUGUUGUGGCGGCCUAAUGGAGG','UAUGAGGGCCCUGCUUAGAAUAAUUUUACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUACUUAUUCUUUAUUGUGGGAU','UUUGAGGGCCCUGCUUAGAAUAAUUUUACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUACUUAUUCUUUUUUGUGGGAU','UUUGAGGGCCCUGCUUGGAAUAAUUUUACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUACUUAUUCUUUUUUGUGGGAU','UUUGAGGGCCCUGCUUGGAGUAAUUUUACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUACUUAUUCUUUUUUGUGGGAU','UUUGAGGGCCCUGCUUGGAGUAAUUUUACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGAU','UUUGAGGGCCCUGCUUGGAGUGAUUUUACAAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGAU','UUUGAGGGCCCUGCUUGGAGUGAUUUUACGAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGAU','UUUGAGGGCCCUGCUUGGAGUGAUUUUACGAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGCU','UUUGAGGGCCCUGCUUGGCGUGAUUUUACGAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGCU','UUUGUGGGCCCUGCUUGGCGUGAUUUUACGAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGCU','UAUGAGGGAACUGUUUGAGGGUGAACGUUCCCGAAACAUGAGGAUCACCCAUGUUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUAACAUGAGGAUCACCCAUGUAUUCUUUAUUGUGGGCCAUCCUCUAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAACAUGAGGAUCACCCAUGUUAAUUCUUUAUUGUGGGCCAUCCUCUAU','AUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUACAUGAGGAUCACCCAUGUAUGUAAUUCUUUAUUGUGGGCCAUCCUCUAU','UACAUGGGUUAAAUGAGGGAGCUGCUUGACAUGAGGAUCACCCAUGUAGACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAACAUGAGGAUCACCCAUGUGACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAGACAUGAGGAUCACCCAUGUACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAUAACAUGAGGAUCACCCAUGUCAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAUAAACAUGAGGAUCACCCAUGUAGCGAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAUAGACAUGAGGAUCACCCAUGUAGCGAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGCUAGACAUGAGGAUCACCCAUGUAGCGUUACUGAUCCCAUGAUUCUUUAUUGUGGGU','GGAGGUGAUCGAAUGAGGGAACUGCGACAUGAGGAUCACCCAUGUGACAGCGCAAAGACAGAUACCUCAAAAUUCUUUAUUGUGC','GGAGGUGAUCGAAUGAGGGAACUGCGACACAUGAGGAUCACCCAUGUCAGCGCAAAGACAGAUGCCUCAUUAUUCUUUAUUGUGC','GGCCAAUGUUGGAACUGCUGUACAUGAGGAUCACCCAUGUGAUAACAUGAUAAUGCUGCCGUCUUAUUCUUUAUUGUGUGACAUC','AAUGAGGGAACUGCUAGAGGUUUUCAGUUCCUUAGAUACAUGAGGAUCACCCAUGUUUGUUCUUUUUUGUGCCAUAUCCACUACA','GAUGAGGGAAAUACUAGAGGGUUUCAGUUCCUAAGAUACAUGAGGAUCACCCAUGUUUGUUCUUUUUUGUGCCAUGUCCACUACA','UCUUAUCUUAUUCUUUAUUGAUCAUUUUUUACAUGAGGAUCACCCAUGUUUUCUAGGUCCGAGUUUUGGGAACUGUUUGUAAUAC','UCUUAUCUUAUUCUUUAUUGAUCAUUAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUUUUGGGAACUGUUUGAAAUAC','AUUCAAUGGUGGAACUGCAUUGUACAUGAGGAUCACCCAUGUAUUAUAGGUGAAGGAUAUUAAUUAUUCUUUAUUGUGUGGCAUC','AAUAUAUGAGGGAACUGCUAGACAUGAGGAUCACCCAUGUUGUUAUAAUCUUUGGGUAAAUAACUUAUUCUAUCUUGUGGUUUAU','GUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCA','GUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUGUUCUUUAUUGUCGGAUCCUCAGCC','GUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUGUUGUCGGAUCCUCAGCC','GUGGGAGCUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','CUGGGAGCUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','UCUUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUAUCCUAGGUCCGAGUUUUGGGAACUGUUUGUAAUAC','AAUGAGGGAACUGCUUAGUACCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUG','GAUGAGGGAAAUACUAGAGGGUUUCAGUUCCUAAGAUACAUGAGGAUCACCCAUGUUUGUUCUUUUUUGUGCCAUGUCCACUACU','UCUUAUCUUAUUCUUUUUUGUUCAUAAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUAAUAGGAACUGUUUGGAAUUC','UCUUAUCUUAUUCUUUAUUGUACAUAAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUAAUAGGAACUGUUUGGAAUGC','UCUUAUCUUAUUCUUUAUUGUACAUAAUAUACAUGAGGAUCACCCAUGUUAUCUAGGUCCGAGUAAUGGGAACUGUUUGGAAUGC','UAGAAUUGAGGGUUCUGCAGAUAACAUCUACAUGAGGAUCACCCAUGUUUAUAAGAUUUGGAUUUUAUUCUUUCUUGUGGUUUAU','UAGAAUUGAGGGUUCUGCAGUUAACAUCUACAUGAGGAUCACCCAUGUUUAUAAGAUUUGGAUUUUAUUCUUUCUUGUGGUUUAU','AGGAUUAGAGGGAUGUGCUUAGUUUACAUGAGGAUCACCCAUGUUUUUUGGUUAAAAGUGUAUUUUAUUCUUUCUUGUGGUAAAU','AGGAUUAGAGGGAAUUGCUUAGUUUACAUGAGGAUCACCCAUGUUUUUUGGUUAAAAGUGUAUUUUAUUCUUUCUUGUGGUAAAU','AGGAUUAGAGGGAAUUGCUUAGUUACAUGAGGAUCACCCAUGUUUUUUUGGUUAAAAGUGUAUUUUAUUCUUUCUUGUGGUAAAU','UUUGUGGGCCCUGCUUGGCGUGAUUUCACGAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGCU','UUUGUGGGCCCUGCUUGGCGCGAUUUCGCGAAGGGAGAGACAUGAGGAUCACCCAUGUAAUUUUGCUUAUUCUUUUUUGUGGGCU','GCUUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUUUUGGGAACUGUUUGUAAUGC','AAUGAGGGCCCUGCUUAGAAUAAACAUAGGGAGAGACAUGAGGAUCACCCAUGUAAAUAAUAAAACUUAUUCUUCAUUGUUGGGU','AAUGAGGGCCCUGCUUAGAAUAAACAUAGGGAGAGACAUGAGGAUCACCCAUGUAAAUAAUAUAUCUUAUUCUUCAUUGUUGGGU','AAUGAGGGCCCUGCUUAGAAUGAACAUAGGGAGAGACAUGAGGAUCACCCAUGUAUAUAAUAUAUCUUAUUCUUCAUUGUUGGGU','AGUGAGGGCCCUGCUUAGAAUGCACAUAGGGAGAGACAUGAGGAUCACCCAUGUAUAUAAUAUAUCUUAUUCUUCAUUGUUGGGU','AGUGAGGGCCCUGCUUAGAAUGCACAUCGGGAGAGACAUGAGGAUCACCCAUGUAUAUUAUAUAUCUUAUUCUUCAUUGUUGGGU','AGUGAGGGCCCUGCUUAGAAUGCACAUCGGGAGAGACAUGAGGAUCACCCAUGUAUAUUAUUUUUCUUAUUCUUCAUUGUUGGGU','AGUGAGGGCCCUGCUUAGAAUGCACAUCGGGAGAGACAUGAGGAUCACCCAUGUAUGUUGUUUUUCUUAUUCUUCAUUGUUGGGU','AGUGAGGGCCCUGCUUAGUGUGCACAUCGGGAGAGACAUGAGGAUCACCCAUGUAUGUUGUUUUUCUUAUUCUUCAUUGUUGGGU','AGUGAGGGCCCUGCGUUGUGUGCACAUCGGGAGAGACAUGAGGAUCACCCAUGUACGUUGUUUUUCUUAUUCUUCAUUGUUGGGU','AAUGAGGGCCCUGCUUAGAAUAAACAUAGGGAGAGACAAGAGGAUCACCCUUGUAAAUAAUAAAACUUAUUCUUCAUUGUUGGGU','AAUGAGGGCCCUGCUUAGAAUAAACCUAGGGAGAGACCUGAGGAUCACCCAGGUAAAUAAUAAAACUUAUUCUUCAUGGUUGGGU','AAUGAGGGCACUGCUUAGAGCCCUGGGAAAUGAAAACCUGAGGAGGACCCAGGUAAGAAAAGAAACUUAUUUUUUAUUGUUGGGC','AAUGAGGGAACUGCUUAGCACAUGGCAAGAAGAAAAUAACAUGAGCAUCAGCCAUGUCAAAAGAUUUUAUUUUUUCUUGUGGGUU','AAUGAGGGAAGUGCUUAGAGCACGGGAAAAUAAAAUAAACACGAGGAUCACCCGUGUAAAAGAAACUUAUUUUUUAUUGUUGGGU','ACUCAGGGAACUGCUUAGACCCUGGGCAAAGAAACAAAACCUGAGGAAAACCCAGGUAAAGAAAACUUAUUUUUUAUUGUAGGGU','AAUGAGGGUCCUGCUUGGCACCGGGUAAGAAUAAAAUAAAACCUGAGGAUCACCCGGGUAAAAGACUUAUUUUUUAUUGUGUGGU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAGAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUCU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUUGACUGAGGGAACUGCUUGG','UUUGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UUGGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAGAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UUGGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGACGGAACUGCUUGG','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACUUCCUCUAU','UGGUCUUCACACUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGUAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGGUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUACCUCGUGUAGACUAAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUACCUCGUGUAGACCGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACGUUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUGAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUUGAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UUAGUGAGGGAACUGCUGAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUACACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACCGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGUACAUCCUCUAU','UGGUCUUCACUUUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUUUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUGUAU','UGGUCUUCACUCUUUUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUUUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACCUCCUCUAU','UGGUCUUCGCUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGGCUGAGGGAACUGCUUGG','UGAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAGCUGCUUGG','UGGUCUUCACUCUUAUUCUUUGUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGCGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUCU','UUUGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAUUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCCUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAAGAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGUACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAGAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUUUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGUACAUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAGUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACGGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUCCCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAUUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUGAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAACUCUUUAUUGUGGGACCUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACGGCUUGG','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAUUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACGGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCCAU','UAAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAUGGAACUGCUUGG','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCCAU','UGGUCUUCACUCCUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGAUUGG','UGGUCUUCACUCUUCUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGUUUGG','UGAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCCAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAGAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUGGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCGAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUUUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGUACAUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAGUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UUUGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUACCUCGUGUAGACGGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUUCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACAGAGGGAACUGCUUGG','UUGGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUAUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGCGUGG','UUAGUGAGGGAACUACUUCUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UGGUCUUCACUCUUAUUCUUUUUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACGUCCUCUAU','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGGAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACGUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAUAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGUUUGG','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGGAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGACGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUGAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAGCAGUAUCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUUUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUGUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUUAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUACAGCAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UUAGUGAGGGAACUACUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACCUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUACUUGG','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACCUCCUCUAU','UUAGUGAGGGAACUACUUAAGAUGGGCCUCACUGGAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUCCCAACAGUACCUCGUGUAGACUGAGGGAUCUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAAUUGCUUGG','UUAGUGAGGGAACUUCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUACUUCUUUAUUGUGGGACAUCCUCUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAUCUGCUUGG','UUAGUGAGGGAACUGCUUAUGAUGGGCCUCACUGUAAAUACAUGAGGAUCACCCAUGUAAUUCUUUAUUGUGGGACAUCCUGUAU','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAAAAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','UGGUCUUCACUCUUAUUCUUUAUUGUGCACAUGAGGAUCACCCAUGUUCCAACAGUACCUCGUGUAGACUGAGGGAACUGCUUGG','AGAUUCUCAGUCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAAUCUUGAGGGAACUGCUUAG','AAAGAGGGAACUGCUUAGAAGGUUGUUCUUCCGGUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','AAAAGAGGGAACUGCUUAGAAGGUUGUUCUUCCGGUUACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','UAAAAGAGGGAACUGCUUAGAAGGUUGUUCUUCCGGUACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUGGGAUCCUCAGCC','AAAACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUAAAAUGAGGGAACUGCUUAGAAAUAAA','AAAAUUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUAAAAUGAGGGAACUGCUUAGAAAUAAA','AAAACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAAAUGAGGGAACUGCUUAGAAAUAAA','AAAACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGCUUAGAAAUAAA','AAAACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUUAGAAAUAAA','AAAACUUAAUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUUAGAAAUAAA','AAAACUUAAUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUUGGAAAUAAA','AAAACUUAAUUUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUUGGAAAUAAA','AAAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUUGGAAAUAAA','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUUGGAAAUAAA','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAACUGUUAGGAAAUUAA','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAGCUGUUAGGAAAUUAA','AUGAGGGAACUGCUUAGUCACCUGGCAGUUCCUGAGAAACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGUGGGUGAUGCCUG','AAUGCGGGAAUUGCUUAUACAUGAGGAUCACCCAUGUUAAACAAGGUUCCUACUAUAAGCUUAUUCUUUAUUGUAGGGAACUAGA','AAUGCGGGAACUGCUUAUACAUGAGGAUCACCCAUGUUAAACAAGGUUCCUACUAUAAGCUUAUUCUUUAUUGUAGGGAACUAGA','AGUGCGGGAACUGCUUAUACAUGAGGAUCACCCAUGUUAAACGAGGUUCCUACUAUAAGCUUAUUCUUUACUGUAGGGAACUAGA','AGUACGGGAACUGCUUAUACAUGAGGAUCACCCAUGUUAAACGAGGUUCCUACUAUAAGCUUAUUCUUUACUGUAGGGAACUAGA','AGUACGGGAGCUGCUUAUACAUGAGGAUCACCCAUGUUAAACGAGGUUCCUACUAUAAGCUUAUUCUUUACUGUAGGGAACUAGA','AGUACGGGAGCUGCUUAUACAUGAGGAUCACCCAUGUUAAACGAGGUUCCUACUAUAAGUUUAUUCUUUACUGUAGGGAACUAAA','AGUACGGGAGCUGCUUAUACAUGAGGAUCACCCAUGUUAAACGAGGUUCCUACUAUAAGUUUAUUCUUUACUGUUGGGAACUAAA','AGUACGGGAGCUGCUUAUACAUGAGGAUCACCCAUGUUAAACGUGGUUCCUACUAUAAGUUUAUUCUUUACUGUUGGGAACUAAA','AGUACGGGAGCUGCUUAUACAUGAGGAUCACCCAUGUUAAACGUGGUUCCUACUAUAAGCUUAUUCUUUGCUGUUGGGAACUAAA','CGUACGGGAGCUGCUUAUACAUGAGGAUCACCCAUGUUAAACGUGGUUCCUACUAUAAGCUUAUUCUUUGCUGUUGGGAACUAAA','AAUGAGGGAACUGCUUAGAAAAGAAGGGAAAACAUGAGGAUCACCCAUGUACAGGCAGAUCCUAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGAGAGAAGGGAAAACAUGAGGAUCACCCAUGUACAGGCAGAUCCUAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGAGGGAAGGGACAACAUGAGGAUCACCCAUGUACAGGCAGAUCCUAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGAGGUAGGGAACAACAUGAGGAUCACCCAUGUACAGGCAGAUCCUGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGUGGUAGGGAACAACAUGAGGAUCACCCAUGUGCAGGCAGAUCCUGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGUGGUAGGGAACGACAUGAGGAUCACCCAUGUGCAGGCAGAUCCUGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGUGGUAGGGACCGACAUGAGGAUCACCCAUGUGCAGGCAGAUCCUGACUUAUUCUUUAUUGUUGGGU','AGUGAGGGAACUGCUUAGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUUGGGUAUAAUCUCU','AGUGAGGGAACUGCUUAGAGGAUGUUCCUUCGGAUAUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUUGGGUAUAAUCUCU','AGGAUUAGAGGGAAUUGCUUAGUUUACAUGAGGAUCACCCAUGUUUUUUGGUUAAUAGUGUAUAUUAUUCUUUCUUGUGGUAAAU','AGGAUUAGAGGGAAUUGCUUAGUUUACAUGAGGAUCACCCAUGUUUUUUGGUUAAUAGUGUAUAUUAUUCUUUCUUGUGGUAGGU','AGGAUUAGAGGGAAUUGCUUAGUUUACAUGAGGAUCACCCAUGUUUUUUGGUUAAUAGUGUGUAUUAUUCUUUCUUGUGGUAGGU','AGGAUUAGAGGGAAUUGCUUAGUUUACAUGAGGAUCACCCAUGUUUGUUGGUUAAUAGUGUGUAUUAUUCUUUCUUGUGGUAGGU','AGGAUUAGAGGGAAUUGCUUGGUUUACAUGAGGAUCACCCAUGUUUGUCGGUUAAUAGUGUGUAUUAUUCUUUCUUGUGGUAGGU','AGGAUUAGAGGGAAUUGCUUGGUGUACAUGAGGAUCACCCAUGUUUGUCGGUUAAUAGUGUGUAUUAUUCUUUCUUGUGGUAGGU','AGGAUUAGAGGGAACUGCUUGGUGUACAUGAGGAUCACCCAUGUUUGUCGGUUAAUAGUGUGUAUUGUUCUUUCUUGUGGUAGGU','AGGACUAGAGGGAACUGCUUGGUGUACAUGAGGAUCACCCAUGUUUGUCGGUUAAUAGUGUGUAUUGUUCUUUCUUGUGGUAGGU','AGGACUAGAGAGGACUGCUUGGUGUACAUGAGGAUCACCCAUGUUUGUCGGUCAAUAGUGUGUAUUGUUCUUUCUUGUGGUAGGU','AGGACUAGAGAGGACUGCUUGGUGUACAUGAGGAUCACCCAUGUUUGUCGGUCAAUAGUAUGUAUUGUUCUUUCUUGUGGUAGGU','AAUGAGGGAGCUGCUUAGUACCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUG','AAUGAGGGAGCUGCUUAGUGCCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUG','AAUGAGGGAGCUGCUUAGUGCCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUG','AAUGAGGGAGCUGCUUAGUGCCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','AGUGAGGGAGCUGCUUAGUGCCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','AGUGAGGGAGCUGCUUAGUGUCGGUGAGCGGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','AGUGAGGGAGCUGCUUAGUGUCGGUGAGCGGUCUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','AGUGAGGGAGCUGCUUAGUGUUGGUGAGCGGUCUUGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','AGUGUGGGAGCUGCUUAGUGUUGGUGAGCGGUCUUGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','AGUGUGGGAGCUGCUUGGUGUUGGUGAGCGGUCUUGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUCAAUGGGUU','UGAGGGUACUGCUUAGGAGACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUAUUGUGUGUGUGUAAUGU','UGAGGGUACUGCUUAGGAGACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUGUUGUGUGUGUGUAAUGU','UGAGGGUACUGCUUAGGAGACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUGUUGUGUGUGUGUAGUGU','UGAAGGUACUGCUUAGGAGACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUGUUGUGUGUGUGUAGUGU','UGAAGGUACUGCUUAGGAAACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUGUUGUGUGUGUGUAGUGU','UGAAGGUACUGCUUAGGAAACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUGUGUUGUGUGUGUGUAGUGU','UGGAGGUACUGCUUAGGAAACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUGUGUUGUGUGUGUGUAGUGU','UGGAGGUACUGCUUAGGAUACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUGUGUUGUGUGUGUGUAGUGU','UGAGGGUACUGCUUAGGAGACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUGUUGUGUGUGUGUUGUGU','UGUGGGUACUGCUUAGGAGACCGGUGAGCAGAACAUGAGGAUCACCCAUGUAGAUGACUUAUUCUUUGUUGUGUGUGUGUUGUAA','UACAUGGGUUAAAUGAGGGAGCUGCUUGAACAUGAGGAUCACCCAUGUGACAGCAAUAGAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAACAUGAGGAUCACCCAUGUGACAGCAAUGGAGAUCCCAUGAUUCUUUAUUGUGGGU','UACAUGGGUUAAAUGAGGGAGCUGCUUGAACAUGAGGAUCACCCAUGUGACAGCAAUGGAGAUCCCAUUAUUCUUUAUUGUGGGU','UACAUGGGUUACAUGAGGGAGCUGCUUGAACAUGAGGAUCACCCAUGUGACAGCAAUGGAGAUCCCAUUAUUCUUUAUUGUGGGU','UACAUGGGUUACAUGAGGGAGCUGCUUGAACAUGAGGAUCACCCAUGUGACAGCUAUGGAGAUCCCAUUAUUCUUUAUAGUGGGU','UACAUGGGUUACAUGAGGGAACUGCUUGAACAUGAGGAUCACCCAUGUGACAGCUAUGGAGAUCCCAUUAUUCUUUAUAGUGGGU','UACAUGGGUUAUAUGAGGGAACUGCUUGAACAUGAGGAUCACCCAUGUGACAGCUAUGGAGAUCCCAUUAUUCUUUAUAGUGGGU','UACAUGGGUUAUAUGAGGGAACUGCUUGAACAUGAGGAUCACCCAUGUGACAGCUAUGGAGAUCCCAUUAUUCUUUAUGGUGGGU','UACAUGGGUUAUAUGAGGGAACUGCUUGAACAUGAGGAUCACCCAUGUGACAGCUAUGGAGGUCCCAUUAUUCUUUAUGGUGGGU','UACAUGGGUUAUAUGAGGGAACUGCUUGAACAUGAGGAUCACCCAUGUGACAGCUAUGGAGGUCCCAUUGUUCUUUAUGGUGGGU','UAUACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUAAAAUGAGGGAACUGCUUAGAAAUAAA','UAUACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUAAAAUGAGGGAACUGCCUAGAAAUAGA','UAUACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUAAGAUGAGGGAACUGCCUAGAAAUAGA','UAUACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUGUAAGAUGAGGGAACUGCCUAGAGAUAGA','UAUACUUAUUCUUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUGUAAGAUGAGGGAACUGCCUAGAGAUAGC','UAUACUUAUUCUUUAUUGUCAGGUGGAACAUGAGGAUCACCCAUGUCAUCUUUGUUGUAAGAUGAGGGAACUGCCUAGAGAUAGC','UAUACUUAUUCUUUCUUGUCAGGUGGAACAUGAGGAUCACCCAUGUCAUCUUUGUUGUAAGAUGAGGGAACUGCCUAGAGAUAGC','UGUACUUAUUCUUUCUUGUCAGGUGGAACAUGAGGAUCACCCAUGUCAUCUUUGUUGUAAGAUGAGGGAACUGCCUAGAGAUAGC','UGUACUUAUUCUUUCUUGUCAGGUGGAACAUGAGGAUCACCCAUGUCAUCUUUGUUAUAAGAUGAGGGAACUGCCUAGAGAUAGC','UGUACUUAUUCUUUGUUGUCAGGUGGAACAUGAGGAUCACCCAUGUCAUCUUUGUUAUAAGAUGAGGGAACUGCCUAGAGAUAGC','UCUUAUCUUUUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUAUCCUAGGUCCGAGUUUUGGGAACUGUUUGUAAUAC','CCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUUUUGGGAGCUGUUUGUAGUCG','CCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUUUUGGGAGCUGUUUAUAGUCG','GCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUUUUGGGAGCUGUUUAUAGUCG','GCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUUUUGGGAGCUGUUUAGAGUCG','GCAUAUCUUAUUCUUUUUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUAUCCUAGGUCCGAGUUUUGGGAGCUGUUUAGAGUCG','GCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUCUUGGGAGCUGUUUAGAGUCG','GCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUCUUGGGAGCUGUUUAGAGUCA','UCAUAUCUUAUUCUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUCUUGGGAGCUGUUUAGAGUCA','AAAAUACUUAUUUUUUAUUGAUCAUCUUUAACAUGAGGAUCACCCAUGUGUCCUAGGUCCGAGUCUUGGGAGCUGUUUAGAGUCA','AAUGAGGGAACUGUUUGAGGGUGAACGUUCCCGAAGAAACAUGAGGAUCACCCAUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGAGGGAACUGUUUGAGGGUGAACGUUCCCGUAGAAACAUGAGGAUCACCCAUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGAGGGAACUGUUUGAGGGUGAACGUUCCCGUUGAAACAUGAGGAUCACCCAUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGAGGGAACUGUUUGAGGGUGAACGUUCCCGUUAAAACAUGAGGAUCACCCAUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGUGGGAACUGUUUGAGGGUGAACGUUCCCGUUAAAACAUGAGGAUCACCCAUGUUUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGUGGGAACUGUUUGAGGGUGAACGUUCCCGUUAAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGUGGGAACUGUUUGAGGGUGAACGUUCCCGUUGAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGUCAUCCUCGGG','AAUGUGGGAACUGUUUGAGGGUGAACGUUCCCGUUGAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGUCAUCCUCGUG','AAUGUGGGAACUGUUUGAGGGUGAAUGUUCCCGUUGAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGUCAUCCUCGUG','AAUGAGGGAACUGUUUGAGGGUGAAUGUUCCCGUUGAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGUCAUCCUCGUG','AAUGAGGGAACUGUUUGAGGGUGAAUGUUCCCGUUGAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGUCAUCCUCGUA','CACAUGGGUUGAAUGAGGGAGCUGCUUCACAUGAGGAUCACCCAUGUAGACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','CACAUGGGUUGAAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','CACAUGCGUUGAAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCAAUAAAGAUCCCAUGAUUCUUUAUUGUGGGU','CACAUGCGUUGAAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCAAUGAAGAUCCCAUGAUUCUUUAUUGUGGGU','CACAUGCGUUGAAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCGAUGAAGAUCCCAUGAUUCUUUAUUGUGGGU','CACAUGCGUUGUAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCGAUGAAGAUCCCAUGAUUCUUUAUUGUGGGU','CACAUGCGUUGUAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCGAUGAAGAUCCCAUGAUUCUUUAUUGUGGGA','CACAUGCGUUGUAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCGAUGAUGAUCCCAUGAUUCUUUAUUGUGGGA','CACAUGCGUUGUAUGAGGGAGCCGCUUCACAUGAGGAUCACCCAUGUAGACAGCGAUGACGAUCCCAUGAUUCUUUAUUGUGGGA','AGAUUCUCAGUCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAGUCUUGAGGGAACUGCUUAG','AGAUUCUCAGUCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAGUCAUGAGGGAACUGCUUAG','AGAUUCUCAGUCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAAUCAUGAGGGAACUGCUUAG','GGAUUCUCAGUCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAAUCAUGAGGGAACUGCUUAG','GGAUUCUCACUCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAAUCAUGAGGGAACUGCUUAG','GGAUUCUCACGCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAAUCAUGAGGGAACUGCUUAG','GGAUUCUCACGCUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAGUCAUGAGGGAACUGCUUAG','GGAUUCUCACACUUAUUCUUUAUUGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUGCCUCAGAAUCAUGAGGGAACUGCUUAG','GGAUUCUCACACUUAUUCUUUAUGGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUUCCUCAGAAUCAUGAGGGAACUGCUUAG','GGAUUCUCACACUUAUUCUUUAUGGUGGAGUACAUGAGGAUCACCCAUGUAUCCCAUUCCUCAGAAUCAUGAGGGAACUGCUUUU','AAUGAGGGAGAUGCUUAGAAGGAUAAAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGAUGCUUAGAUGGAUAUAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGAUGCUUAGAUGGAUUUUAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGAUGCUUAGAAGGAUUUAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGAUGCUUAGACGGAUUUAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGAUCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGAUGCUUAGUCGGAUUUAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGUUCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGCUGCUUAGUCGGAUUUAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCAUGUUCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGCUGCUUAGUCGCAUUUAAUCUACAUGAGGAUCACCCAUGUAUUCACCCUCGUGUUCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAGCUGCUUAGUCGCAUUUAAUCUACAUGAGGAUCACCCAUGUAUUCGCCCUCGUGUUCUUAUUCUUUAUUGUUGGGU','UAAUGAGGGAACUGCUUAGAAGGGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUAAGCU','AUAAUACUUAUUCUUUAUUGAGGGAAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAUCUGCUUAGUAAAAUU','AUAAUACUUAUUCUUUAUUGUCGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAUCUGCUUAGUAAAAUU','AUAGUGAGGGAACUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUGAGGGAACUGCUUGGUCACCUGGCAGUUCCUGAGAAACAUGAGGAUCACCCAUGUUUAUUCUUUAUUGUGUGGGUGAUACCUC','UUAGUGAGGGAACUGCUUAGUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUGGGCAAUUCUCAU','UUAGUGAGGGAACUGCUUAGUAGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUGGGCAAUUCUCAA','AAUGAGGGAACUGCUUAGUACCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUU','AAAUGAGGGUACUGCUUAGUCCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUU','UACAUGAGGGAACUGCUUAGUCGGUGAGCAGUAUAGUAACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUU','UAAAAUGAGGGUACUGCUUAGUAGUCGGUGAGCAUAGUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUU','UAAAAUGAGGGUACUGCUUAGUAGUCGGUGAGCAUAGUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGGUUAAAUGGGUU','UACUAUGAGGGUACUGCUUAGUAGUCGGUGAGCAUAGUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUCGUGGUUAAAUGGGUU','UACUAUGAGGGUACUGCUUAGUAGUCGGUGAGCAUAGUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGGUUAAAUGGGUU','UAAAAUGUGGGAACUGCUUAGUAGUCGGUGAGCAUAGUACAUGAGGAUCACCCAUGUCUUAUUCUUUAUUGUGGUUAAAUGGGUU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUAAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUAUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCAUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUUUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAAUUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAAUUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUAAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAAUUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUAUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAAUUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCAUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAAUUGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUUUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACUACUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUUAAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCUAUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUCAUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAAUACAUGAGGAUCACCCAUGUAUAUUUUUUAUUGUGGGCAAUUCUCAAU','AUAAGUGAGGGAACUGCUUAGUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUUUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUAGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUAAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUAUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCAUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUUUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUAUAGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUAAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUAUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCAUUAUUGUGGGCAAUUCUCAAU','AUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUUUUUAUUGUGGGCAAUUCUCAAU','AUAAUACUUAUUCUUUAUUGAGGGAAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAAUAAAAUU','AUAAUACUUAUUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGUAAAAUU','AUAAUACUUAUUCUUUAUUGAGGGAAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAAAUGCUUAGUAAAAUU','AUAAUACUUAUUCUUUAUUGAGGGAAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCUUUUUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCUUUAAUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCUUUAUAGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCUUAAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCUAUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAUUCAUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACAGCUUAGUAAAAUU','AUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAUCUGCUUAGUAAAAUU','AUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGUAAAAUU','UUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGUAAAAUU','UUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACUGCUUAGAUAAAUU','UUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAAAUGCUUAGAUAAAUU','UUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACUACUUAGAUAAAUU','UUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAACUGAUUAGAUAAAUU','UUAAUACUUAAUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAGCUGCUUAGAUAAAUU','UUAAUACUUAUUUUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAGCUGCUUAGAUAAAUU','UUAAUACUUAUUUUUUUUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAGCUGCUUAGAUAAAUU','UUAAUACUUAUUUCUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAGCUGCUUAGAUAAAUU','UUAAUACUUAUUCUUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAGCUGCUUAGAUAAAUU','UUAGUACUUAUUCUUUAGUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGAGCUGCUUAGAUAAAUU','UUAGUACUUAUUCUUGAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGAUAAAUU','UUAGUACUUAUUCUUUCUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGAUAAAUU','UUAGUACUUAUUCUCUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGAUAAAUU','UUAGUACUUAUUCCUUAUUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGAUAAAUU','UUAGUACUUAUUCUUUAUCGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGAUAAAUU','UUAGUACUUAUUCUUUACUGUUGGGAAUAACCCUCUACAUGAGGAUCACCCAUGUUAUAAAAUGAGGGUACUGCUUAGAUAAAUU','UUAGUGAGGGUACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUUUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACUGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUUUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUUUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUAAUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUAUAUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCAUUAUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACAGCUUAGAUUGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUUUUUAUUGUGGGCAAUUCUCAAU','UUAGUGAGGGAACAGCUUAGAUAGGGCCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUAAUUGUGGGCAAUUCUCAAU','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUAGAUGAGGGAGCUGUUAAGAAAUUAA','UUAGUGAGGGUACUGCUUAGAUUGGGUCUCACUGUAUACAUGAGGAUCACCCAUGUAUUAUUCUUUUUUGUGGGCAAUUCUCAAU','UUAGUGAGGGUACUGCUUAGAUUGGGUCUCACUGUAUACAUGAGGAUCACCCAUGUAUUGUUCUUUUUUGUGGGCAAUUCUCAAU','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAUUUGAUGAGGGAGCUGUUAAGAAAUUAA','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAAUUGAUGAGGGAGCUGUUAAGAAAUUAA','ACAACUUAAUUAUUAUUGUCGGGUGGAACAUGAGGAUCACCCAUGUCAUCCUUGUUAAUUGAUGAGGGAGCUGUUAGGAAAUUAA','GUGGGAGCUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUGUUCUUUAUUGUCGGAUCCUCAGCC','GUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUGUUCUUUAUUGUCGGAUCCUCAGUC','GUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUGUUCUUUAUUGUCGGAUCCUCAGUA','GUGGGAACUGCUUGGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','AUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGAUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','AUGGGAACUGCUUAGAUGAGGAUGUUCCUUCGGUUAAACAUGAGGAUCACCCAUGUACUUAUUCUUUAUUGUCGGAUCCUCAGCC','AAUGAGGGAACUGCUUAGGGUAAACAUGAGGAUCACCCAUGUAAAAUAAAAUAAAUAAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUAACAUGAGGAUCACCCAUGUAUAAUAAAAUAAAUAAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUAACAUGAGGAUCACCCAUGUAUAUUUAAAUAAAUAAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUAACAUGAGGAUCACCCAUGUAUAUUUAAUUUAAUAAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUAACAUGAGGAUCACCCAUGUAUAUUUGAUUUAAUUAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUAACAUGAGGAUCACCCAUGUAUAUUUGAUUUCGUUAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUCACAUGAGGAUCACCCAUGUGUGUUCGAUUUCGUUAUCCUCAGCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUCACAUGAGGAUCACCCAUGUGUGUUCGUUUUCGUUAUCCUCGGCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUCACAUGAGGAUCACCCAUGUGUGUUCGGCUUCGUUGUCCUCUGCUUAUUCUUUAUUGUUGGGU','CAUAUAUCGAAAGAUAUAUGACUGAUUUUUUGUCGUGGGUACAUGAGGAUCACCCAUGUCCUUAAUAAGGUGAGGUAUUGUUUAG','AAUGAGGGAACUGCUUAGGGUUCACAUGAGGAUCACCCAUGUGUGUUCGGCUUCGUUGUCCUCAGCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUCACAUGAGGAUCACCCAUGUGUGUUCGGCUUCGUUGUCCUCAGCUUAUUCUUUUAGGUUGGGU','AAUGAGGGAACUGCUUAGGGUAAUAACAUGAGGAUCACCCAUGUAAUAAAAUAAAUAAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUAAUAACAUGAGGAUCACCCAUGUAAUAAUUUAUAUAAUCCUCAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUAAUAACAUGAGGAUCACCCAUGUAAUAAUUUGUAUAAUCCUCGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUAAUAACAUGAGGAUCACCCAUGUAAUGUUUUGUAUAAUCCUCGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUAAUAACAUGAGGAUCACCCAUGUAAUGUUUUGUUUAGUCCUCGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUAAUAACAUGAGGAUCACCCAUGUGGUGUUUUGUUUAGUCCUCGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUUAUUACAUGAGGAUCACCCAUGUGGUGUUUUGUUUAGUCCUCGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUCAUUACAUGAGGAUCACCCAUGUGCUGUUGUGUUUCGUCCUCGACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUCAUUACAUGAGGAUCACCCAUGUGCUGUCGUGUUUCGUCCUCGGCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGUUUUAAUAAAACAUGAGGAUCACCCAUGUAAAGCCCAAGUCAUGUUUCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGUUUUAAUAAAACAUGAGGAUCACCCAUGUAAUGCCCUAGUCAUGUUUCUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGAAACAUGAGGAUCACCCAUGUAAAAUAAAAUAAGAUCCAUCAAAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGAAACAUGAGGAUCACCCAUGUAUAUUAAAAUAAGAUCCAUCAAAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGAAACAUGAGGAUCACCCAUGUAUAUUAUAAUAUGAUCCAUCAAAACUUAUUCUUUAUUGUUGGGU','AAUGAGGGAACUGCUUAGGGUAACAUGAGGAUCACCCAUGUAUAUUAUAAUAUGAUCCAUCAAAUCUUAUUCUUUAUUGU
Photo of LFP6

LFP6, Player Developer

  • 598 Posts
  • 108 Reply Likes
@Eternacac: Just saw that you had posts caught in the spam filter. If any got double posted and should be deleted, let me know.
Photo of eternacac

eternacac

  • 274 Posts
  • 19 Reply Likes
Thanks for the heads up. This forum and I have unexplored issues with posts and comments. I don't seem to be able to track it very well, so I don't know if there are any double posts or not. And I'm unsure how I offended the spam gods. So, do whatever you find acceptable to clean it up, with my permission.