Feedback thread for the upcoming NOVA port update

  • 4
  • Idea
  • Updated 4 years ago
Please post bug reports, feedbacks and/or comments here. Thanks
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes

Posted 4 years ago

  • 4
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
The "unique barcode" while designing a lab submission isn't working as I expected it to. I went to http://nova.eternadev.org/game/browse... and selected a lab for view/copy. At this point, the bar code should be a duplicate, but it isn't diagnosed as such by the widget in the upper left. I tried publishing the design (with no mods) and there it was rejected as not having a unique barcode, as expected.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
This feature is hard to test properly, because the state of the round and which barcodes are currently used on that server instance may not match. Thanks for the report but there's little I can actually test before we're live.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Is the database used while working on the design different from the one used when it is submitted?
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
I can't really tell, but I verified that the applet reacts properly to the list sent by the server when the puzzle is pulled. On the prod server, that list is maintained consistently, but I strongly doubt anyone cares to do the same on the dev server...
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Opening and closing the chat window has always been a sore point with me; the hot spot area doesn't align with the visible icon. The new version is no worse than the old, but since you are in the code, I'd really appreciate it if you were to expand the responsive area so that clicking anywhere on the visible icon, at least, would work.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
From the testing I just did, I cannot reproduce what you're saying: the clicking area does match the icon.

But I agree that it's a hard one to hit precisely. I will look into enlarging the reactive area for this button.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Thanks.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
I increased the clicking area by 255% (from 12x6 to 16x16). It's still small, but things should be slightly better.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Superb! That's everything I could want. One fewer frustration in life! Thanks again.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
It should have been done a long time ago, sigh... My pleasure :)
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
nice
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
I noticed something else not related to the port, but seems like low hanging fruit at this point. When viewing the dot plots for a switch, the lower triangle (MFE) updates according to the state, but the upper triangle (base pair probabilities) doesn't.

Since I am gathering increasing confidence that the two dot plots can be interpreted in a way that is very predictive of the lab switch fold change, this seems more important than it did in the past.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
It may seem like a low hanging fruit, but unfortunately, it is everything but.

The matter of fact here, is that, to my knowledge, there are no folding engines with proper support for ligand binding. It is not included in Vienna, and I never saw that feature in any other folding engine.

In EteRNA, we never had more than hacks coded by Jee. The very first version was demonstrably quite poor. The current switch 2.5 version of the hack gives acceptable results in most cases (I can give an example where it fails though), though limited to MFEs. No partition functions.

In simple words, this hack can't compute the partition function of sequences in the presence of a ligand like FMN, and its accuracy for MFEs suffers from a conceptual flaw.

I'll mention again my personal effort at https://github.com/ElNando888/vrna-hack which is meant to address precisely this problem, but this is not available in the game.

If all you need are dot plots, then may I offer collaboration? It is probably deactivated now, but I once had a nodejs script running on a cloud server that had just that function: produce (hopefully accurate) dot plots, given sequence and ligand+concentration. Would this help?
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
I'm definitely interested in estimating the partition function of the bound state for the purpose of predicting Kd values in the MS2 labs. I have yet to get any experimental validation, but my plan had been to use the pair probabilities generated by Vienna's partition function evaluated for the sequence with the FMN constraints. Although I can appreciate that using the constraints is not exactly the same as using the actual ligand binding, it seemed like a reasonable approximation. Is this not the same aproximation nando.eternadev and the game UI use to calculate the MFE for the bound state?

I have looked at https://github.com/ElNando888/vrna-hack, but not diff'ed it against the original in order to understand your mods. Did I scan right over the explanation of what you did? Unfortunately, that happens.

(This discussion has wandered from the original topic; I'm fine with moving it elsewhere if you prefer.)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Update: I went back and looked at the switch-scores-for-eterna-switch-puzzles topic and see that 7 days ago, you did explain the differences I was asking about.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
(I'm fine talking about it here, as long as we're only commenting on your original feature request)

The thing is, neither Jee's method, nor my constrained folding trick can work for partition functions. A constrained fold just skews everything, but it can work for MFEs provided you're careful with what you're doing (checking bonuses and differences in free energies). Jee's switch2.5 method is cleaner, but for one, he didn't bother extending it to the partition function part of the engine, and anyway, it still fails in regard to partition functions, because the calculations are based on a localized binding site.

Take the switchmaker, paste these 2 structures:
.........(((((.....)))))...((((((...........))))))..((.((((....)))).))..........
.................((((......(((((....))))).....))))..((.((((....)))).))..........
and then, paste this sequence:
AAAAAAAAAUCUCAAAAUAUGAGGAUAUAUGUCAAAACAUAGAAGGCAUAGAAGGCAUAAAAAUAUGGUUAAAAAAAAAA

Now add the molecule where it belongs. It works right? The applet would gladly let you publish the puzzle, but in fact it should not.

Remove the molecule, and paste this sequence in place of the bound state:
.......((((......((((......((((((...........)))))).....)))).......))))..........

With the above sequence, and in presence of FMN, *this* should be the MFE. The original puzzle should NOT solve with that specific sequence. That's the flaw in Jee's algorithm, that I tried to carefully address in vrna-hack.

And my Vienna hack is the only way I know of to get proper partition functions when ligands are added to the solution, because it will consider all possible binding conformations, not just a single pre-specified one.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Hi Nando!

Thx for the chatbox turn on and off in the gears. Big tumbs up for that.

I also like the highlight of unsolved areas directly in the puzzle, as an alternative to enlarging the minimap. It is now very visible where the problem is. :)

Problem

Ok, I also have a big problem to report. :)

One of the new changes has broken the lab archive and made much harder accessing the lab data and do analysis. Usually there were a persons symbol at top middle of the screen. But it is gone now. Instead is a lab list button at the bottom. But this does not do the same thing.

All I want after seeing the lab design I looked up is to get sent directly back to where I came from and have the lab list as I sorted it. Count: 1 click.

The persons button at top middle screen worked for that. It sent me back and nothing was changed in the lab list and I could go on watching designs. And the lab list was sorted as I had it sorted and with what ever number limits I had put as filters in the columns.

What happens instead:

Click 1: Instead I'm send to the web version of the lab list.

Click 2: A new window opens. I have to get back into the classic view

Click 3: I have to close the window with the design I came from

Several clicks later: I have to reset my sorting of the data all over again

Additional click: Open next lab puzzle that was all I wanted was to get send directly back to where I came from so I can get on with watching the next design on the list, after whatever sorting criteria I set up in the first place.

And all this just to get from one design in the lab list to the next.

Example


http://eterna.cmu.edu/game/browse/242...

Solution suggestion

Get the lab list button send us to classic eterna lab list (or web for those who so wishes) like the persons button did before. I just want what ever link was attached at the previous person button to replace that in the new lab list button.

Why I don't use the web version of the lab

The web version of the lab list isn't working for many reasons some of them brought up in here and a lot of those have not been fixed:

https://getsatisfaction.com/eternagam...

Just to highlight a few of the most serious:

- One can't shift between SHAPE and base colors in just one click, it takes multiple.

- If I do tiny changes like change between SHAPE colors and base colors, then I have to input all the numbers I used for sorting in the columns all over again. Web version is as usual eterna - but with absolutely no memory.

- When shifting back and forth between functions like base colors and SHAPE, the screens don't overlap and remember where I was looking, when I shift between SHAPE color and base color. In the classic lab list, the position of the lab list doesn't change, just SHAPE color and base color.

Imagine that the design turned up in two different corners of the screen when you do a simple shift between base colors and SHAPE and not overlapping as it does normally. Thats basically what happens for the lab list.

The return of the jedi

The more clicks we have do to just get at the design/data and the more tedious it is made, the less work we can do.

May the force guide you to minimize all the clicking :)
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
As a matter of fact, Eli, the only things I changed for these buttons, are their appearances and their positions. Specifically for this button, I'm positive that I didn't touch the functionality. The "send to the web-based lab browser" action was implemented before I started accessing the code back in December, and I didn't touch it at all. This means, it's been like that for many months, and this was not a part of the Nova update.

This said, I agree that it doesn't make much sense to go to the web-based list when you came from the Flash applet... There's probably an easy fix, I will look into it.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Hi Nando!

Yes, it has been a big problem before, but for a while it has somehow been gone. Not sure what happened then. It maybe a problem for some labs and not for others. It has been happening before. Usually the active labs are not touched by it.

Crossed fingers for you and it being an easy fix. It will make things a lot easier for us.

Big thx!
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
I believe you haven't touched that function, as this is an old returning problem and has bugged us for long. In the hope it can help I can add that Johan's microRNA and MS2 switch labs are working fine not only when active, but also when closed. It is the older labs that are touched by this problem of not allowing eterna flash users to stay in flash as soon as the lab goes to the archive. Hope this can help you pinpoint the difference between past and new labs.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Hi Nando!

I was copying out an link address to a design in the new lab view. It just took me a second to realize that I'm wishing for your elegant solve on copying out the design sequence.

I simply wish the OK button to be like your dismiss button for sequence copying and just fade away in the background without us having to click on it to make it disappear. This will help a lot.



Another small note. These two links, the design URL and the one to all the players designs URL are not underlined, making it harder to see they are links.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Hi Nando!

I love that you got the shortcuts for meltplot and dotplot shortcuts really working.

(Background details: Can be called with shortcut (S) and minimised with (M). If there is no reaction, just click in the lab design and the all the keyboard shortcuts should be activated. This goes as a rule for all shortcuts.)

Before the shortcuts for meltplot/dotplot has never really worked, because one had to open the dot plot/meltplot manually first to get the keyboard shortcuts working, which kind of looses the point.

Found one small thing. I can manage to get both the minimized and big plot showing at once. No biggie. For my sake it can wait till after the other bigger issues. Basically the function works, which it didn't before. So big thx from here.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Jieux brought up in chat that the base pair numbers were gone in the base picking tool in the updated version. NOVA made their version for puzzles and made it simplified as to make it easy for players all new to eterna. However for lab work, I very much want these numbers and information back directly in the puzzle where I need it.

Yes, I can see the number of base pairs in the lab list - if or after the design has been submitted. But I will like that kind of info directly in the design when I'm looking at it, not having to go look it up elsewhere or counting manually when designing or voting.

Past view:



New view:
Photo of drake178

drake178

  • 44 Posts
  • 5 Reply Likes
I guess I'm not going to add this to my own question after all. I'm a minute too slow =P

Now the only question is, should I copy that over here?

https://getsatisfaction.com/eternagam...
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
@Eli: as I just mentioned in chat, I don't think I will be changing any of this. In puzzles, if there's a constraint, then the information is there. In labs, you are one hotkey (s) or one click away from the information. In conclusion, I see no good justification to going back to cluttering the interface.

As for the puzzlemaker, hoglahoo had a good idea about the publishing dialog, and I may try to implement that one.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
@Nando, I do understand you want it clean. But this specific clutter is useful info. Its far nicer each time one don't have to click to get to something. It quickly adds up to a lot of clicking. I think the old interface was more useful at this specific point.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
if I have to weigh between being able to click the pairs tools more easily, or having the numbers of pairs information immediately accessible, the choice has to be the ease of use for pair tools.

The one easy to fall in trap is to add and add and add more information in an interface and clutter it. This palette is an action bar. It should have tools, and markers to show which one is the currently active one. This by itself is already taking a very large portion of the space. Trying to squeeze statistics there is unwise, specially when it's not really necessary.

I think the Nova guys made a wise choice here, and I'm going to stick to it, unless someone can prove to me that it's isn't as good as I think.
Photo of jandersonlee

jandersonlee

  • 549 Posts
  • 122 Reply Likes
It *is* useful to know without extra clicks. Perhaps write the count above the pairing symbols?
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
@jandersonlee: so "useful" and indispensable that it takes 5 days (15 if I count the public preview, 30 if I count the closed previews, which Eli had access to) for anyone to notice they're missing...

This said, there might be enough space where you're suggesting, so I'll look into it, but no promises.
Photo of drake178

drake178

  • 44 Posts
  • 5 Reply Likes
The numbers are replaced by the "pairs" selector, which, in turn, is much less visible than highlighting the nucleotides two at a time. It also shouldn't matter where you click between the two nucleotides. That is, whether you click the icon at a height right between the center of the circles or at a height just above the lower border of the icon.

With that, the pair icons become completely irrelevant. Their only remaining use would be the highlight, which was much better done in the old interface (the highlight was about 9 times the current size).

Is it a case of the pair selectors acting as separate buttons on an action bar and the highlights having to be constrained within that button?

/* rant
As for the 5/15/30 days... I really shouldn't bother, but... It wasn't even Eli who spotted this. It might have taken him a whole lot longer to be honest. But it doesn't matter either. All it takes is just that one occasion when we would like to know. Eli picked it up for the same reasons I would have. I found it important and useful before. Which means I don't want to lose it on account of someone just saying "it shouldn't be that way, because we've (re)designed it this way".

He also took it up to make sure it gets mentioned. Because, let's face it, most people won't come here to post. Even if they noticed it 30 days ago. On that note though, I don't think a lot of people were actually interested in either the closed or the public preview. Especially since we've seen this interface before. Most people don't care until they have to actually cope. You can say it's wrong all you want but that attitude is not going to change the situation.

It's much more befitting a group of scientists to plan ahead and go live with feedback and time allocated. To work together to create something everyone is happy about.
rant */
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
On a different note, I have regularly wished that I could choose between having base pair numbers shown or their percentages.

The reason why, is that when I design, - then I usually aim for a good range for base pair percentages as I have seen it in other similar shaped labs. However those similar labs don't always hold exactly the same number of base pairs. Which makes the base pair percentages a more useful measure of similarity than base pair count.

So having the base pair percentage would allow me to shoot closer to the range I want, either from looking at past labs or from experience. Instead of having to judge what base pair percentages estimates to what base pair count.

We get both percentage and number of base pairs in the lab list. I wish to be able to get both these informations in the lab design - not at once - but by choice. Preferably by being able to change settings between seeing percentage or base pair count and have it shown directly in the base picking tool.

Demonstration in lab tutorial of use of base percentages for shooting for a good range of putting ones design in and how I have been finding it:

Limited by nature - Learn about the GC sweet spot



When I'm designing for lab, I'm interested in base pair percentage.

When I'm analyzing lab data, I'm mainly interested in base pair count.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
@Eli: I tested jandersonlee's idea on my dev instance, see for instance http://nando.eternadev.org/game/puzzl... and since it looks somewhat acceptable, it will be pushed to prod soon. This said, I remain completely unconvinced about the usefulness of this information, and whether it is primordial or not to have it directly available in the solving/designing interface. I still feel this is a bad idea.

Your additional request about its format (counts vs percentages) will go on my feature request list. At the moment, there are way too many other "construction sites" and I really need to focus on them in the near future.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
@Nando, I like your test out of jandersonlee's idea. Big thx for listening and even picking up the idea with base percentages. This is sweet news as it is something I have been wishing for, for a long time. I'm apologizing for the clutter.
Photo of Brourd

Brourd

  • 439 Posts
  • 79 Reply Likes
While I don't know anything about the final UI for Eterna-cell and the future, scripting capabilities will eventually be integrated into the game.

If it has not already been proposed or given consideration, it may be useful to code another popup dialogue box or window (or link it to the current pairing probabilities plot window) that contains information about the RNA sequence, based on a few default parameters as well as other statistics that a player may want generated with custom scripts. This could include scoring information, base pair counts, % of base pairs, relative distribution of base pairs throughout the secondary structure, secondary structure composition, energy barriers between targets, etc.
Photo of mat747

mat747

  • 130 Posts
  • 38 Reply Likes
Hi Nando

Past lab
Old browser
Possible oversight in the UI for labs that are Waiting for synthesis results. like http://eterna.cmu.edu/game/browse/573...
http://prntscr.com/6zk01m
Could you remove the box that shows how many Votes and solutions that a player have left, Once the round has closed that box is no longer needed ?

New browser
Could you move the “Old lab browser” Box up to the other menu options ?
As this could create more screen space.
http://eterna.cmu.edu/web/browse/5736...
http://prntscr.com/6zqp8c
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
hi Mat, and thanks for posting this here, this is indeed preferable to PMs :)

About the Flash-based design browser (what you call 'old'), I'm quite uncertain of whether the applet has ever been informed of the status of the round. You are very correct that the information is useless, once the round is closed, and that it looks quite silly and ugly, specially when the chat is missing too. But I need to see with John how this can be properly signalled to the applet. I've noted this on my todo list.

The web-based browser (which you call 'new') is all under John's control. This is a bit off-topic here, but I'll inform him.
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
On http://eterna.cmu.edu/game/puzzle/583..., when entering sequence
AUUACGUACGACAUGAGGAUCACCCAUGUAAUUCGAUCAAUCAAGCUUUCUAUUUAAUGAAACAUACGUACUAGGUAACAUGAGGAUCACCCAUGUGGGUAUGAGU
All conditions appear normal, and state 1 and 2 look good, but that little face on the left top says that the MS2 hairpin does not form. Is that intended? Or shouldn't one of the two states at the right at least look a little bit red?
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
actually, since it appeared again in
GUUGCGUGCGACAUGAGGAUCACCCAUGUACUUCGCUCAGUCACGCUUUCUGUUUACUGCCCUAUUCGUACUUGGUUACAUGAGGAUCACCCAUGUAGGUUUGUGU
I presume this is intentional and not a bug. Is this smiley face the replacement for the "NO" state before? IF so, it'll be hard for new folks to grasp the idea, I think, but that's ok, leave it, I like the graphics.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
The basic infrastructure of the Flash applet only has support for a few simple constraints. For most puzzles, this is plenty enough, but specially in labs, there are cases where this is insufficient. For instance, in the specific context you mention, while it's very easy to specify that both MS2 hairpins should form in a specific state, it is not possible to require that *neither* MS2 hairpins be formed.

We had two possible paths to fix that problem. Either "complexify" the applet to make it support a variety of new exotic, but rare contraints. Which comes at a high price: the code becomes more prone to bugs, code maintenance and implementing new features becomes harder (because one need to be careful not to break the existing feature set). In short, the code becomes more monolithic, and "heavier" (not only to manage, but the binary size also grows with routines very rarely used)

The other route was to flexibly expand the applet's capabilities by making use of EternaScripts. This seemed to me a lot more future-oriented and light-weight. It also comes at a price: first encounters may be disconcerting for players. So far though, it didn't seem to cause too much trouble. I would guess that the red outline prompts users to hover the mouse over the constraint and read the error message.

Some improvements could certainly be considered. For instance, in the case of a scripted constraint with structural requirements (like the one you're referring to), we could imagine that the script could eventually point out which bases are "faulty" in the puzzle, by way of some highlighting maybe. It's on my todo list, don't expect it very soon though (sorry)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
I am having a lot of trouble with the scroll bars (both horizontal and vertical). Specifically, I click with the intent of scrolling to a different place and nothing happens.

One issue is the scroll bars themselves. They have no outline to make the border evident, and in places the background blue is indistinguishable from the scroll bar blue.

The other, I realized, is that the hot spot for the error cursor is not where it seems to be. For an arrow cursor, one expects the hot spot to be the tip of the arrow. Because of the dark blue background coloring, the cursor shape is visually defined by the white outline, not the dark area that visually demarcates it on a light background. As a result, I am actually clicking about two pixels lower than where I think I am. (This is probably why I earlier claimed that the hot spot didn't align with the visible icon, and you couldn't reproduce that.)
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
Hi, and sorry for the late reply.

About the cursor, the bad news is that I don't even know where to start looking for a possible fix. Most of the time, this is hardware-accelerated, and I can't imagine that the Flash applet actually toys with these things... I'll dig in the docs, but I'm not optimistic...

As for the scrollbars, these were the design decisions made by "pros", the NOVA Lab team. Not being a trained UI designer myself, I'm reticent about questioning these things without the opinion of a specialist. Fortunately, we do have someone in the current team who should be able to tell me what's the right thing to do. I'll ask him at the next meeting.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Thanks for following up, Nando. What you came up is a big improvement.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
I discovered a problem with the highlighting of designs (using ctrl-click) in the design browse list -- the marked items can spontaneously change, for no apparent reason. There is some loose correlation with pressing or lifting the control key, but it can happen with no more activity than moving the mouse. Here's an example.

First a screenshot after marking 4 designs

I was intending to continue this pattern of marking every two, but without any clicking or pressing of keys, the screen changed to this:
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
This issue is not related to the NOVA port, it's quite an old one, and until now, I thought I was the only one who actually noticed it. So I had stacked it at the absolute bottom of my todo-list.

Since someone else is inconvenienced by it, I'll raise this issue's priority a bit, but unfortunately, it is quite likely that it will take some longer time (easily weeks) before I can actually look into it.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
The last two lines of the list view seem to be always empty, even if there are more designs below.
Photo of Meechl

Meechl

  • 81 Posts
  • 27 Reply Likes
I was solving some non-spacebar puzzles for a change today, found a minor complaint with the restraint boxes in the upper left, and was wondering if it tricked anyone else.

GU and AU pairs say "x or more," whereas GC pairs say "less than x," so having x GU or AU pairs is okay, whereas having x GC pairs is not okay.

goals

So, in the above example, at first glance I would assume that 8 GC pairs is okay, and be disappointed to find out I have to remove yet another GC.

I would prefer for the GC pairs to say "x or fewer" if we continue with this format. :)
Photo of Brourd

Brourd

  • 440 Posts
  • 79 Reply Likes
http://eterna.cmu.edu/game/puzzle/532...

While messing around with this puzzle in PiP mode, attempting to activate the shape constraint highlighter in the 3rd state causes the applet to crash until it's deactivated.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
Unfortunately, I had no luck trying to reproduce that one. Do you have a specific sequence?
Photo of Brourd

Brourd

  • 440 Posts
  • 79 Reply Likes
CUGCCGAAACGGUGGAGUGCGCAAAGCGUGCACUGAUCAAAGAUUGGAGUGGCCAAAGGCUGCAGUGAGGAAACCUUGC with this sequence, the puzzle animations in the applet freezes in the second and third state (the background bubbles are still moving, so I don't believe flash has crashed. This being on a different computer, OS, and browser from the original incident.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
Well, this is clearly no crash, otherwise the applet would become totally unresponsive. And I would be unsurprised to find out that this is another bug in the highlighting code, which predates both the Nova port and my accessing the Flash code. I corrected an obvious one already, but it looks like there's more... I'll investigate.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
and bingo, that's a very old bug, one of those I like to categorize as "butchered copy/paste", and amusingly, it would only sneakily trigger if your instability map has a lonely first base marked as unstable...

The fix will come in the next update. It is unclear when exactly this will happen though...

Thanks for the report.
Photo of Brourd

Brourd

  • 440 Posts
  • 79 Reply Likes
Two bugs.

1. If you press the screenshot button twice, in quick succession, after the first op-up dialogue box is dismissed, the second proceeds to darken the screen but the dialogue options are not available to dismiss it, making the puzzle inaccessible.

2. Weird bug. Clicked on a link in chat, which caused all the subsequent and previous text in chat to be underlined. Unable to reproduce, so no clue what happened there :P
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Nando, this is a long-standing bug. But given that you've gotten familiar with the Flash code, I took some time to better characterize it, in the hope that it might make it fairly easy to track down and fix.

When moving the mouse over the expanded dot plot, there is a tooltip-type window that gives the coordinates. of the point under the cursor. But although the coordinates start out correct, they "quickly" become incorrect. I've now identified completely reproducible scenarios, both for making them become incorrect and getting them reset to correctness.

To make them incorrect, simply move the mouse pointer outside of the dot plot. Bring the pointer back to the dot plot and they are wrong.

To get them back in synch, click on the zoom "-" area and move the pointer directly back to the dot plot.

Getting base pair coordinates is actually something I use quite a bit. Now that I know how to work around it, short of closing and re-opening the dot plot, it's a little less important to me that it be fixed. Still, it would be awfully nice if it could just work right.

Thanks again for all your work!
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
Another probably related symptom is that sometimes, it just doesn't work at all, with coordinates "frozen" at (0,0) no matter where you move the cursor...

Sigh... noted. As you can imagine, this is low priority, so it may take some time before I can actually tackle that one.

Thanks for the report though.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Bug report.

GU isn't counted correctly in state 2 of switch puzzles.

Example:



From this lab design:
http://eterna.cmu.edu/game/browse/575...
Photo of Brourd

Brourd

  • 440 Posts
  • 79 Reply Likes
This is probably a bug related to the game not counting any of the base pairs formed by the miRNA dimerizing with the target sequence.