FMN/MS2 Riboswitch Structure

  • 1
  • Article
  • Updated 3 months ago
This is a new thread for analyzing FMN/MS2 Riboswitch Structure puzzles, starting with the puzzles in R101.
We are very excited about the results which have been posted in Eterna:
http://www.eternagame.org/web/lab/6369201/

and the data can be found in
Google spreadsheets: FMN/MS2 Riboswitch Structure
or the Excel file: FMN/MS2 Riboswitch Structure
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes

Posted 3 years ago

  • 1
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes

Pseudo necks with end bits


I have been thinking about if we could benefit from Salish's end bits elsewhere than the neck. In particular in relation to the FMN/MS2 Riboswitch Structure: the Paper lab.

In some of these labs the designs are rotated, so the static stem that is attached to their aptamer is not a neck, but a hairpin stem.

I am wondering if if even such a "pseudo neck" could be benefiting from "end bits" or rather mismatches to give a little relaxing effect - even though it can't be flexible in the same way as a neck.

Now I would like to have a Riboswitch on a chip design with a pseudo neck in it, to test this in. But since I don't, I took the second best option and used my high scorer in the R2 lab, which has a static stem in the switching area.


Score 92%

http://www.eternagame.org/game/browse/6204761/?filter1_arg1=6348262&filter1_arg2=6348262&filter1=Id


I removed the tetraloop G boost as I don't want it disturbing the experiment - as it will end up as boost base to some of the new "end bits". I'm aware that this may result in a different score compared to the original design. So I run a design with that change alone. Then I have added an U base somewhere in the loop to avoid more than 4’s in a row.



Also I didn't want to add the end bits themselves in the tetraloop as tetraloops whatever their loop boosts and mismatches, could be far too stable for the effect to show. And likely rather have a stabilizing = stiffening effect. So I have removed the G boost (base 37) and later adding in a base in the loop to avoid more than 4 A's in a row.


Experiment name: #Pseudo necks with end bits


Could you guys think of any similar experiments that could be worth doing?
(Edited)
Photo of Brourd

Brourd

  • 433 Posts
  • 79 Reply Likes
I believe the experiments #mutate_one from jandersonlee's logic gate submissions in the previous round of logic gates seeks to answer similar questions. It should be possible to make targeted mutations to various parts of the puzzle (or run something similar to M2) in order to create a profile for the reactivity of a sequence with MS2 and the various ligands used, as well as a look into the structures the sequence is probably folding into.

So if the goal is to determine how closing base pairs alter the result, mutate all closing base pairs. Increase and decease the lengths of helices to match your hypothesis.
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
Mutate the hairpin length, then as previously mentions, use the typical 16 endbit permutations.
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
Also, you mention to avoid more than 4 A;s in a row. Apart from having found int he past that that tends to lower the cluster density - do you foresee stability issues with the RNA ?
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
Global fold change and switch simplicity

There are two patterns that stands out in a good deal of the designs that receive a high global fold change - the bigger the better as Johan says. Designs that do great at switching not just at the lab fulfilling concentrations but also at additional concentrations tested beyond that.


These designs types also show the most basic way to reduce amount of magnet segments.



Lane sharing

R3, score 100%, fold change 16.44, global fold change 12.71



  • Global fold change range up till 14% for now

  • Lane sharing by sequence overlap between switch elements.
  • Reducing the area of the design complex

  • Reducing the amount of magnet segments


Sequence sharing seems the strongest strategy for now. I think the reason why this sequence sharing work so well - is by making the sequences actively share - the inputs are pretty much made dependent on each other. If concentration affect the one switch element - it is bound to affect the other too - and opposite. Since they share.


R3 designs like jandersonlee’s winners that have input complements share lane with MS2. Here MS2 and TB B turn each other off by sequence sharing. When the one is gone the other will be gone too. When TB A is on TB B will be gone as they are sharing lanes and TB A will be gone when TB B is there, as for TB B is using some of the bases that TB A would otherwise have needed.


At the same time, the sequence and lane sharing results in an overall reduced area of the RNA design complex. The smaller the actual switching area, the easier the switch goes.


R3 overviewjpg


R3 most simplifiedjpg


R3 yet simplerjpg




Static stems in the switching area


R2, score 92%, fold change 8.75, global fold change 6.78

http://www.eternagame.org/game/browse/6204761/?filter1_arg1=6348262&filter1=Id&filter1_arg2=6348262


  • Global fold change range up till 7%

  • Reducing the amount of magnet segments


I have high hopes of this strategy being particularly beneficial for designs with more than 1 input. As it is a way to strongly simplify the design - and a simpler design is easier getting switching. The fewer switching base pairs, the easier the switch.


That said, the sequence sharing and overlap strategy seems to be the overall best. Then introducing static stems in the switching area if possible and should that fail, I think using the full RNA sequence with the RNA inputs spread more out, is next step to go.


R2 overviewjpg


R2 most simplifiedjpg


R2 yet simplerjpg


So even while the designs with a static stem in the switching area are being partially locked, they till now have achieved a higher global fold change than full moving switches without sequence sharing. Those have reached a 5% global fold change for now. I look forward to see if that trend continues.



Related post: Christmas snake

(Edited)
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
Eli & others -- are there designs that follow these principles but do poorly? if so, is there a simple explanation for why they do poorly?
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes

There are a lot of other design in my R2 series with Static stem in the switching area, that didn’t make it to high score. Even a far smaller second and different series.


Notice there are only minor variations and slides.

Static stem in switching areapng


I think my R2 design with static stem is this kind of design that has a real narrow sweet spot. Since I am indeed breaking up the pairing of the A input that needs to stay in second state.


So this means while Static stem in the switch area is a real strong method for getting a smooth switch, having the input complements overlap is the far more secure and higher yielding method - like jandersonlee’s R3 winners that are doing extensive lane sharing.


The sharing style however still can’t be changed too much either. When first the sequence have been made to overlap they can’t be slided in relation to each other without also losing what made them fit together. Otherwise sliding one or more of the elements in an already good design is a strong method for getting multiple more good mutation starting points that will potentially give even better designs and far more of them.


The designs that puts the oligo complements in either end of the RNA sequence - like most of the Logic gates winners - and keep the MS2 away from both - ie no sharing and not overlapping - will have far wider possible options for sliding and mutation that will lead to winning designs - although also a ton of worse ones. But this solve style involves far more switching base pairs and thus may not reach the same high fold change and especially not the same high global fold change.


Basically - and literally they are the full moving designs of the logic gate labs. ;) Although many of the winning designs avoid this partly by reusing a good deal of the folds from neighboring states. The less changed between states, the easier to get it to work.


So compressing the design complex is a way for getting a simpler and good working solve. But when you have first hit on a good one, it can’t be changed too much without losing what it possesses. Just as in the riboswitch on a chip winners, where I deleted important elements and bases and got the design score and fold change mostly went to hell.

Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
There are also examples of the lane sharing designs in R2 that did poorly (and none of them doing real well) and now I think the main reason for that, was that I placed the design complex at the late end of the design (3'). Earlier in the single input microRNA labs that end seemed to be the better end. But two input labs behave differently from 1 input labs. :)

However when a design complex that is having 2 inputs and not using the full RNA sequence, I am starting to think that it will benefit from a 5' positioning of the design complex. At least that is the case for the R3 and XNOR winners.

I can't know for sure, but I have done experiments in the current open round and moved both winning designs and designs I thought ought to have done better, to each the opposite side of the sequence.
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
Correction. I think that 92% static stem in switching area design worked so particularly well, is due to its complement overhang. (Search for the section: Oligo complement magnet prolongation - short and long range) The other designs in the series don't have it.

What I say still holds. There are quite a narrow road for making this type of design work. But when it work, it will work real well.

Complement overhangpng
http://www.eternagame.org/game/browse/6204761/?filter1=Id&filter1_arg1=6348262&filter1_arg2=...
(Edited)
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
Rhiju. The short answer to your question is yes. We will try to segregate out the issues that led to such low scores.
Photo of Jennifer Pearl

Jennifer Pearl

  • 197 Posts
  • 31 Reply Likes
Rhiju. I am running a new analysis of the static loops using DPAT for rounds 1,2, and 3 together based on what we have discussed in this thread. It will take me a little while to do but I will let you know what the results are.
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes

More on this complex placement discussion - which is related to switch design simplification.


What has Gibbs energy got to do with it?


I have been puzzled ever since we got data back from from the two rounds with RNA in and RNA out. The winners in the two labs with miRNA-in, reporter-out showed totally different trends when it came to positioning of the design complex.


Here is how I define “design complex”. Any RNA design that do not take up the full length of the RNA sequence. In other words a design that leaves space at one end for tying up a dangling end into a static stem.


The reporters and the input were rather short compared to the full RNA sequence. But each lab had the design complex placed at either end of the RNA sequence. I had expected them to land at 3’ end as in the microRNA 208a lab. However two input labs behaves differently on this account.  


Lately I have been thinking that the 5’ end is the best for whatever design complex needing a good spot on the RNA sequence. Reporter-out round 2, R3, XNOR have their design complexes show up at the 5’ end. But that doesn’t explain the miRNA-in Reporter-out round 1 lab that has its winners design complex show up at the 3’ end.


So in the latest A/B lab round, I have deliberately been moving well working design complex to the opposite end of the RNA sequence, plus did the same to some not so well working design complexes, that I suspected would benefit from the moving.


I noticed while moving some of these designs that the overall kcal either got more negative or less negative. The ones that were good that I moved to opposite end, got less negative. The ones that did not do well, and that I moved to the other end, got more negative. I started to wonder if there was a relation.


Here is a sum up I have written with my thoughts on the placement of the design complex in the RNA sequence.


The position of the design complex



Kcal and legos


I also recalled how Ksteppe tried to explain to Janelle and me a long time back, that RNA really wanted to have the most negative kcal. Something that didn’t made good sense, as we have both been seeing designs with very negative kcal - as according to simulation - fail miserably in lab. However the point is exactly that it was a simulation kcal. In nature things tend to go towards the more stable state. In switches we are walking a fine balance, as each state will need to have some stability to it, while still allowing the other to be possible also.


As Janelle kept insisting on understanding this odd free energy concept and Ksteppe found an awesome way of explaining free energy, using just legos.


Understanding Free Energy (using Legos)



Omei’s reporter labs and design complex end position


I looked at the reporter lab results again and in both miRNA-in and reporter-out labs I moved some of the top scoring designs to opposite ends. And the winners in general got less negative with the moving. Except a few cases with Omei’s designs in the round 1 miRNA-in reporter-out lab - that may actually benefit from an opposite end placement.


I finally think I may have found out why the winners in these two reporter labs have their design complex end at each their end of the design. Each design complex strives to get the most negative possible kcal. And the end that provides it, is the end the design complex will choose.


I afterwards realized that Omei has already done an experiment that actually goes to demonstrate. He made two series with identical design complex and slided the one series to the opposite end of the other.


http://www.eternagame.org/game/browse/6116601/?filter1=Id&filter1_arg1=6142990&filter1_arg2=6142990


The designs that are in the winning series generally are more negative. And tend to have their design complex towards the 3’ end.


I searched with that switching sequence that Omei mentioned he had used for his experiments and got a few more of his series pop up in the search as well. Not all these designs have the design complex placed at either end, but all contain the same sequence for the design complex.


Notice how the score seems to go down in relation to the energy becoming less negative.



I can get equal or more negative energy if I slide a few of the designs. If I slide the design below to opposite end, it gets an equal energy, so this one may benefit from reversal. Case with even energy no matter which end - in simulation...


Original, Omei TB in/out 1 v3, score 100%

http://www.eternagame.org/game/browse/6116601/?filter1=Id&filter1_arg1=6142990&filter1_arg2=6142990


Hypothetical, slided


The V2 design in the same series actually gets more negative kcal when slided opposite in second state, but not first. 


This miRNA-in reporter-out round 1 lab also show more ambivalence when it comes to scores and fold change. Those are quite fine, but are weak in comparison with the miRNA-in reporter-out round 2 lab, that with 5' end position does far better. But again these two labs also have different length reporter, so I can't fully say which is causing what.


So perhaps a few of these round 1 winners would also be happy at the 5’ end. But my point is that negative energy as we have it for the 1 state in the data overview may actually help to say something about which end to place a design complex at.



Sum up on design complex placement


So my summed up advice for bots and humans in case they are having a design that is not taking up the full RNA sequence, is to place the design complex at whatever end, that gives the most grumpy kcal for 1 state. Make that Gibbs energy go negative!


That be either if the design complex is due to use of lane sharing, static stems in the switching area or just plain short inputs, as in the reporter labs.

(Edited)
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
Lane sharing seems to be prevalent in this
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
Tandem aptamer design is cooperative switch

Just wanted to add that PWKR's double aptamer design, is not just a double aptamer, it also seems to be a cooperative switch. 

The best of the designs with double aptamers receive almost triple the amount of fold change, compared to the single aptamer design with best fold change

Best double aptamer design - fold change of 155
Best single aptamer design - fold change of 52

Johan made a sweet graphics overview of single aptamers versus double aptamers versus double aptamers with mutations in one of the aptamers.

Some of the double aptamer designs with mutations in one of the aptamers, still were able to get double fold change of those of a single aptamer design.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
The Footprint of a switch design...



                
                Image credit


I have identified some signatures that are specific to either switches or static designs. Each have their specific base and base repeat frequency fingerprint.

Finger print of a switch, high amount of purine (GA) and pyrimidine (CU) repeats


http://www.eternagame.org/game/browse/6369184/?filter1_arg1=6456004&filter1=Id&filter1_arg2=...


Frequency differences between switches and static designs

Here are some characteristics that can be used to separate static designs from switches. On suggestion by Mat I have split the pointers so there are one set for primary sequence and one set for secondary structure.


I have used 2 switch and two static designs for illustrations of how base frequency differs between the two types of designs. The static designs have more in common with each other, than switches and vice versa. These frequency differences seems general for switch and static lab designs based on what I have seen so far.


The static designs have more in common with each other, than switches and vice versa. These frequency differences seems general for switch and static lab designs based on what I have seen so far.

Frequency spreadsheet with numbers of repeats and bases, for the example designs.



Highlights


Switch designs
  • Switches designs have a high ratio of pyrimidine repeats to purine repeats. Almost 1.16 - 1.23.

  • Pyrimidine repeats high (33-38%)

  • Purine repeats high (29-31%)

  • Percentage of A and G bases, close to each other

  • Percentage of C and U bases, close to each other


Static designs

  • Static designs have a higher amount of repeat A’s and A bases in general, compared to switches
  • Static designs have a high amount of purine repeats (64-78%)

  • Static designs have a low ratio of pyrimidine to purine repeats. Less than 0.2




Rules for primary sequence


Characteristics of static design


  • Base: A repeats high

  • Sequence: Purine repeats high

  • Sequence relations: Ratio of purine to pyrimidine repeats low (0.15-0.16)


Example of A repeats (Almost all in loop area)

http://www.eternagame.org/game/browse/2712700/?filter1_arg1=2736920&filter1=Id&filter1_arg2=2736920


Example of Purine repeats (Most in loop area)


Example of low pyrimidine (green) to purine ratio (red)



Characteristics of switch designs


  • Sequence: Pyrimidine repeats high

  • Sequence: Purine repeats high

  • Sequence relation: Ratio of purine to pyrimidine repeats high (0.80-0.85)


(Repeat bases seems to make weaker binds - meaning they will also easier switch.)


Example of high pyrimidine (green) to purine ratio (red)



http://www.eternagame.org/game/browse/6369196/?filter1_arg1=6461353&filter1=Id&filter1_arg2=...


Rules for secondary structure


Characteristics of static design


  • Base pairs: Well mixed bases

  • Repeat bases in loops - a purine repeat stretch is just a word for loop or single base area

  • Purine repeats in loops

  • Visual: Asymmetry

  • Visual: All loops, stems, internal loops, multiloops of different size

  • Energy modeling: Even energy distribution

  • Base pairing: Varied bases in stems (avoids slides and unwanted complementarity)


Example of well mixed stem bases

http://www.eternagame.org/game/browse/2712700/?filter1_arg1=2736920&filter1=Id&filter1_arg2=2736920


Example of fairly even energy distributions in stems of similar length


From the forum post Energy, structure and symmetric colors



Characteristics of switch designs


  • Repeat bases - in stems and switch elements (eg aptamer/MS2)

  • Pyrimidine repeats in stems and switch elements (eg aptamer/MS2)

  • Purine repeats in stems and switch elements (eg aptamer/MS2)

  • Visual: Symmetry

  • Visual: Similar size elements

  • Energy modeling: Uneven energy distribution

  • Base pairing: Complementary pairing between stretches of the repeat bases (purine pairs with pyrimidine


Example of identical size elements - two repeat FMN’s

http://www.eternagame.org/game/browse/6369196/?filter1_arg1=6461353&filter1=Id&filter1_arg2=6461353


Example of some symmetry



Complementarity between repeat sequences




Beneficial repeats in static stems


Furthermore, the pyrimidine repeats and purine repeats also seems to be beneficial for switches, even when it is static stem area. I have been seeing it and scratching my head. It pops up in our switches and switches found in papers.



Earlier example from this post.

There is even a fine pattern for single bases C and U to be more close in percentage to each other than G and A. Plus G and A being more close in percentage to each other than C and U. A logic consequence of raised amount of purine base pairing with pyrimidine in switches.



Slightly different ratio of purine and pyrimidine in ON/OFF labs?


I took the top scoring design in the 8 Logic Gate labs, (max 1.25 fold change error). In 6 of 8 designs, pyrimidine repeats had a higher ratio than purine repeats. Except for A OR NOT B (TTFT) + OR (FTTT), where purine repeat ratio dominated over pyrimidine. They are both ON switches.

There may be a tendency for ON switch needing a little higher ratio of purine compared to pyrimidine, compared to OFF switches.

This fits the pattern of ON switches (INC) labs doing better with the TB inputs heavy in pyrimidine - because this will raise the potential for purine repeats in the design. And OFF switches (DEC) doing better with the TB inputs heavy in purine - because this will raise the potential for purine repeats in the design. (OFF switches wants C magnet landing sites, ON switches wants G magnet landing sites)



Purine/pyrimidine content - a good predictor for a good input for an ON or OFF switch?


Even more the switch signature with higher ratio of repeat pyrimidine compared to repeat purine, may actually go to explain why Round 1/3 OpenTB inputs were less good than Round 2 OpenTB inputs. (LINK to background post)

The first input set (OpenTB Round 1/3) have a higher ratio of pyrimidine in them, hence sparking a high purine content in the resulting designs. Whereas the second set (OpenTB round 2/4) holds a high purine content in them, hence sparking a higher pyrimidine content in the designs. The latter being favorable to make working switches. Working OFF switches in particular.

The high pyrimidine content of our early cloud lab switches were not a coincidence. (Periodic repeats in RNA switches - How can they be programmed?)



Perspective - What can this be used for?

  • First of all making better designs. :) Knowing an optimal percentage of different bases, purine repeats, pyrimidine repeats and the ratio of pyrimidine repeats to purine repeats, will considerably up your chances of making a working switch.
  • Choosing better inputs for ON and OFF switches
  • Data could be pulled pulled from a larger set of designs from a round of switches and static designs, to get the accurate percentage of bases and repeats that are normal frequency for these design types.
  • Based on these pointers, it should be possible just based on a sequence, to say something about if a sequence is a likely stable design or it may be a switch.

  • These destinct signatures for switches and static designs could be finetuned by finding them for whole rounds in spreadsheets for the winning designs.
  • Eventually this could get used for what Rhiju would love to see. Digging natural RNA switches out of the sequence soup of RNA data bases or raw sequence outputs from nature.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes

The structural language of RNA


I will tell a story similar I told in the post above, with some of the same images, but I will tell it in a different way.


What I wish to illustrate, is that just the frequency of bases used for a small stretch, already spills quite a lot about what kind of structure it will make. Albeit what it will end up forming, also will depend on the base frequency of the whole sequence, but also by complementarity from other subsequences.



How to spell the word LOOP in a RNA sentence


When I say use a stretch of mainly A bases (but not purely A for 6+ base stretches) this is af if I’m using a word that says loop. 



These A stretches are really just words for something that will be loop, be single base like multiloop ring or gap bases.


Like 


GAAAUAA says internal loop or hairpin loop

AAUAA says internal loop, or gap bases or multiloop bases


That is if the overall sentence is to spell static RNA design.




How to spell the word Stem in a RNA sentence


Similar, if I use a small stretch of well mixed bases - a mix of all 4 bases - A,U,C and G - then I'm really saying find a partner and make stem or fold up with yourself, if there is internal complementarity.


Stem sequence in static designs have a different base frequency to loops. Loops are high in A base frequency, stems are not. The stem base frequency will change slightly depending of if this stem is long or short. Shorter stems will tend to be higher in GC content, longer stems will tend to be higher in AU content plus hold more GU also. Similar longer stems can tolerate more repeat bases, than shorter stems.




The surroundings change the meaning of a word


So to get to a specific structure, you will need to put together the right words. Plus make sure their surroundings does not make them mean something entirely else than what you intended. Nice doesn't mean nice if it is placed with a couple of other words like this: Not so nice. 

Stems in switches and static designs have a different base frequency of their base content. Switches harboring much more pyrimidine and purine stretches - in other words less well mixed base pairs.


What will determine if a sequence spells static design or switch, is its general base frequency, its amount and type of repeat bases plus their ratio in relation to each other.  


Stretches of purine in static designs also tends to mean loop, or loop plus a G base from a stem. If the overall sequence is to spell switch design, the exact same subsegment with a stretch of purine bases, can mean build switch element - be it part of an switching loop or a switching stem.



If the sequence has a high amount of purine repeats, but a low amount of pyrimidine repeats, then there is a likelihood of a static design. (Above)



If the sequence has a high amount of purine repeats, but also a high amount of pyrimidine repeats, then the likelihood of a switch design is high. (Above)


What structure a specific subsequence will become, will depend of if there are complementarity inside itself or if there is another "make stem region" that is complementary. So just short stretches of bases already have pre built orders (demands) into them.


GCAUC - spells a strand of a potential stem 5 bases long. Especially if there is GAUGC elsewhere


GCAUCAUAAGAUGC says hairpin stem


What structure will form, is all a matter of the frequency of the bases that are put together. Plus how many repeats there are. Plus if there are potential complementarity


To make stems, specific complementarity is needed. To make multiple stems, the stems should preferable all be different both in internal solving sequence, but also in size. Else the puzzle is not going to be stable.


On the other hand, for switches having several stems solved exactly the same way and in the same length, is a way to secure a controlled switch, between alternative conformations.  



Designing for a specific structure from scratch


Words that have the correct frequency of bases in them to really spell loop when loop is needed or really spell stem, when stem is needed. Plus each time you add a new stem, you need to have its word not match up with a word for another stem.


I think this with focus not just on making complementarity between elements (satisfying the ingame energy models) but also the focus on correct base frequency to fit the desired puzzle type (switch/static), and using the correct repeat base ratio, can actually be used to increase the likelihood of building a wanted structure from the get go. Plus last but not least, rule out a ton of unwanted sequences. 


As I love to say, RNA is really only a game of frequencies. Use the right ones!


Thx to Mat for discussion

Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
Switches love repeat bases but...


Switches love repeat bases and repeat sequence in particular. But not all kind of repeat bases are equally welcome in a switch.  

I will use a couple of the designs that I shared in the posts above, for illustration. 

            Static design with lots of repeat A's. 
            
            https://eternagame.org/game/solution/2712700/2736920/copyandview/


NB: The A repeats with weak yellow are outside the design itself. Belonging to the design scaffold. But still there are double the amount of A repeats and they are longer.  

            Switch design with low amount of repeat A's.
            
            https://www.eternagame.org/game/browse/6369196/?filter1_arg1=6461353&filter1=Id&filter1_arg2...


NB: Here there is even an extra FMN aptamer, raising the amount of A repeats by 1. 


A script to determine purine and pyrimidine content of a sequence

I have made a script (Purine and pyrimidine repeats finder 1.04) that can count the purine and pyrimidine repeats in percentage and print them. 

Here is a demonstration of the script run on the above designs. 

Sequence of static design: 
GGAAAGUAGAGCGGCAAAGCGAAAUAAAUAAAAGCAAGUAUCGAAAAGAUACAAAAGCGGCCUACAAAGUACAGCUUCGGCUGUACAAAAGAAACAACAACAACAAC




Sequence of switch design: AUGGUUGUCGUAGGAUAUGUAGGAUAUUCCUACAUGAGGAUCACCCAUGUUCGCAUGGAAGAAGGACAGAAGGACGAUAACCAC




Running the same script with GU and CA instead: 


The more repeat A's, the less of a switch

If I run the script searching for A repeats instead, it looks this way: 

Static design: 


Switch design: 




Other repeat base markers of switches

I have been scolding longer stretches of GU's in switches. And I still think they are disadvantageous if the stretch of GU's is really.  

However when I ran my base count script but changed the bases to GU and CA repeats instead, they just as purine and pyrimidine repeats, got a similar ratio to those of pyrimidine to purine repeats. Roughly something like 70 %, which is skewed to random distribution. If it had been more random, I would have expected a 50% ratio. Another rough guess for switch base ratios are 40% GA, 30% CU, 40% CA and 30% GU. 

Again this is a base repeat ratio that differs between switches and static designs. If I run the two designs through a modified version of the script, there is a clear ratio different between GU and CA in switches and static designs: 

Static design, a ratio of CA to GU of around 3. 


Switch design, a ratio of CA to GU of around 1


The longer the base and sequence repeats gets, the more different they get. Similar they can't be all same length. 



Potential explanation for switch repeat sequence?


I have been wondering about what if there were another mechanism involved in switching too. Because CA and GU repeats are not of the same kind as purine and pyrimidine. They are more like the tooths of a zipper. I think that combined with repeat bases may make for weakness and a potential switch. 




Sum up: Where do switches and static designs differ?

  • Switches holds way less A repeats than static designs + they are shorter
  • Switches holds more C repeats than static designs
  • The more and longer A repeats in switch, the lower a switch is likely to score
  • When switch designs gets stretches of 3+ repeat A's or above it starts hurting their scores. Similar if there are a lot of shorter repeat A bases. Giving a quick guess I will recommend a limit of max 10% A repeat bases. 


(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2216 Posts
  • 477 Reply Likes
Simple demonstration of growing disadvantage of longer A repeats in switches

Here I search the AC/INC lab from OpenTB round 2 by amount of repeat A's. The more A's, the fewer winners. 

                  Sequence AA
                  
                  Sequence AAA
                 

                  Sequence AAAA
                  

                  Sequence AAAAA
                  


Repeat A's in full rounds

A similar pattern goes for the whole round of the 101 riboswitch lab

Sequence AA



Sequence AAA


Sequence AAAA


Sequence AAAAA


So far I can recall seeing just one winning switch design with 7 A bases. As far as I recall it was one of Omei's.

It was before repeat A's got limited to max 4 in a row. 
(Edited)
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
I am going through the old data to see how to potentially summarize my endbits analyses in a document.

I came across this in the R93 data. Why does the fmax,FMN deviate from the azimuthal once the eterna score exceeds 90?

Anybody got some idea?