How Eterna players can generate 100,000 promising OpenCRISPR designs in just eight weeks

  • 3
  • Question
  • Updated 2 years ago
  • (Edited)
Well, here we are, with a new challenge and an experimental capacity for analyzing 10 times as many designs as ever before.  Wow!

I can imagine that many experienced players rolled their eyes a bit when then saw the goal of ~100,000 submissions, thinking there was no way we could get so many players to generate so many solutions.  But really, there is method in this madness.  Hear me out. :-)

There are a total of 32 puzzles, most of which have a per-player limit of 150.  That means each of us has a potential for submitting ~5000 solutions.  I know of a handful of players who can actually do this with the tools they have available.  Five players generating ~5000 designs comes to a total of ~25,000 designs, which is more than twice as many as we've ever had in the past, but it is still far short of 100,000.

How is it possible for a single player to create 5000 designs in two months?  They don't all use the same techniques, but what they all have in common is having access to programs/scripts to do a lot of the heavy lifting of generating and/or evaluating possible designs.  What I want to do is to make one or more of these automation tools accessible to 100 players, instead of only 5.

Here's an example that has been rolling around in my head the last few days.  Say you have a design you think is promising.   Maybe you created it, or maybe another player created.  In either case, you bring it up in the game and decide on a way to experiment with variations.  You mark the bases you would like to modify with the black marker, and load the Awesome booster from the booster menu.  You then choose what kind of mutations you would like to see (mutations, deletions, ...) and what screening criteria (e.g. satisfies constraints with Vienna2) you would like applied.  You click on a button and BOOM! you have a list of all the designs that satisfy your request.

At this point, you can choose to scroll through the designs to see how they look in the game and trim the list down as much as you want.  When you are satisfied, you click another button to submit the remaining designs and ... (well it won't be BOOM!; maybe you should go take a nap) your computer will do that for you.

Jandersonlee has already laid much of the groundwork for a booster like this.  But it  will take more work to turn it into something that is easy accessible and useful to any player.  And that is really the whole point of this post -- to recruit players who are willing to contribute their time and skills to making this (or other ideas) into reality.  Typically, the skill in shortest supply is Javascript experience.  But a lot more than coding goes into software development, like figuring out a really good UI, testing, organizing, cheering, etc.

The floor is now open for discussion.  Let the Force be with you.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
  • euphoric

Posted 2 years ago

  • 3
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
@Omei: when I saw the 90,000 + submissions goal, I knew we were about to experience a game changer.  A quick look at the puzzles and I thought 900 submissions might be a stretch for me. I set a goal for 30 submissions per puzzle for myself.  Not sure I can do it.
I welcome this challenge to muster the players to step the game up a notch.

There has been a great topic going on under "analysis" here in the forum.  It's Brourd's "Coder Required" topic. It's an evolving fascinating discussion, but I don't understand the context of "structure, shape, ensemble, motif etc.". I can code some basic javascript, but I wouldn't know where to begin from their discussion so far.  It's my lack of understanding them, not their presentation.

I can imagine two channels of discussions.  One by players to propose tactics and choose a few for testing. One by coders to translate the tactics into code and provide feedback to the players if the coding process is not clear. The more clear the mission as defined by the players, the less coders and coding time would be required.

Hopefully, this post will:
1 Identify interested players.
2 get suggestions as to where channels of discussion should take place.
3 Define the mission of each channel with short timeline goals.

PS: The booster link above does not work.  It says "could not get page block for ......"
I tried the link with and without the last backslash with the same result.    
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@whbob Without scripting support, I doubt any player has enough time and patience to submit 5000 designs, especially if they put any thought into them. :-)  Thus this push for make at least some level of automation available to all players.

I think Brourd's analysis topic has been very interesting.  But analysis has its own requirements that are more complex than sequence generation/submission.  I haven't taken an active part in that discussion merely because it seems like too big a topic for me to come to grips with right now.

I like your suggestions for building momentum.  Hopefully more players will continue to chime in.

Re the booster link, it should be fixed now.  But you may have to force a browser page flush, or just use this: http://www.eternagame.org/web/script/7466741/.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
@Omei: Thanks, the link is working now. I've read the code. If I click start from copy, what comes next? I think that I must save it some way as my own code because we can't run other players code.  Correct?
Once I get to run the code, maybe I will be able to understand what the script does.    
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
For most boosters, you can "start from copy", make sure that the Script Type is still Booster and click on "Submit Script".  The script should now appear when you press the lightning bolt icon in the game.

But because jandersonlee's booster modifies the UI and needs code around to handle the user interactions, it falls in the category of "asyncronous" boosters, and needs some special treatment.  In this case, you need to replace the 7466741 in
the lines
   // IMPORTANT: when copying, edit line 6 to reflect your URL script id
   var blv4Sid = "7466741";
at the top of the script with the ID of your copy of the script, which you can pull out of the browser's address bar.  Make sure to click SubmitScript (again, perhaps) after making the change.

If you care to know the other special voodoo about asynchronous scripts, see http://eternawiki.org/wiki/index.php5/Flash_API_for_Boosters#Synchronous_vs_Asynchronous).
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
@Omei: After "submit script" I saw the url change and I copied down my script ID number. I got out of script and went back in, tried to search on my iD and was left hanging. Saw the search by date and clicked on it to see my script at the top of the page. Saw the edit button, clicked on it to edit the ID number in the code to reflect my ID.  
Went to Control ON puzzle in the new labs, clicked on the lightning bolt, clicked on "script executer" and a box asked for my ID. Entered it and the HTML boxes (windows) appeared along the bottom.  Pulled the bulk loader data box over to expand it horizontally.  The only thing I got to respond was the mutate button. It mutated every base and pasted the full sequence for each mutation. All reported false of course because I did not have a design with constraints met to begin with.  

If any of the other buttons are active, I could not tell by just messing around.
I have more questions, but I'll save them for a better channel perhaps in slack.  
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Experiment Template - Science 101

I have an idea that I think can help us players design our own experiments. 

Really it is your idea, Omei. :)

I just transferred and rotated it a bit, just as if it was an RNA design. ;) 


Science Template Across Labs


I had long been claiming that the FMN aptamer had a favorite orientation in relation to the switching area. I knew I was right as scores the new labs that had the FMN orientated as I wished to see it, seems to go in the right direction. But I didn't have a way to demonstrate in a short and easy manner so everybody would understand. 

Omei demonstrated across different labs, how the different FMN aptamer orientation affected average fold change and max fold change. And put it in a easily viewable manner. 


Science Template Inside a Single Lab

I think we can snatch that template and adapt it to designs in a single lab with different groups of experiments run against each other. (I even suspect the template could be automated later.)

I have put up a google doc with a couple of examples of how to shift Omei's overview for a lab round until something that can be used to test hypothesis in a single lab: 

Science Template

I also put up the labs and their links in a spreadsheet. One could also put up hypothesis like this. 

Science Experiment Template

For those who haven't followed the related discussion, I have put up a collection of hypothesis I think is worth testing. Plus how to mark designs with hypothesis using # (Hashtags)
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
This mesh beautiful with my thoughts, Omei.

Dream demonstration. I love how you demonstrate the future booster.

And it is probably easier agreeing on hashtags between two players for starters. I even dissagree with my past self. :)

I think you are right on track with what you wish to see tested.

Just as I suspect the bases right around MS2 have a huge effect on the switch, I believe the ones around FMN to do so. I am currently using some I have generally seen in winning designs. In particular at the closed end of the aptamer.

You have suggested a method to test this systematically and I think we collectively holds the capacity to get the job done.


One more fun experiment
  • I have been considering just for the fun of it to throw in crossed GU's (can be done in two ways) at the 4 base spot you have highlighted in your last image - in a set of different designs.(At the non switching end of the aptamer)
This with the specific intention of destabilizing the area and see if we can get the CRISPR part to interact somehow with the Riboswitch part and if that would have any effect.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Additional thought on submission of designs in one go.

It would be helpful having something to tell them apart. So they are not all called the same. So either they get a 1,2,3 etc. Or as jandersonlee's script does - add a specifier for the specific mutation. So if base 34 is mutated to a G, the title would bear the mutation name G34.

Thought on the FMN surroundings experiment. I suspect it will be beneficial splitting the experiment of probing the bases around FMN into two sets. The 4 bases before and the 6 bases after. Here is why. The 6 bases after - at least for exclusion labs are partly decided by MS2.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Oh, I did get in basepairs around aptamers in the Hashtag Experiments doc. However I was mainly thinking of the closing base pairs. The whole area will be interesting. Adding it in.
(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Re "It would be helpful having something to tell them apart. So they are not all called the same. So either they get a 1,2,3 etc. Or as jandersonlee's script does - add a specifier for the specific mutation. So if base 34 is mutated to a G, the title would bear the mutation name G34. ", I agree.  I figured that would be the responsibility of the booster script.
Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
How about using names also for data in the excel spreadsheet? For example:
"#DistanceFromAptamer Distance=5 Mutations=23G12C Note='Full of buldges'" Or will these be other parameters in the query?
Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
I want to point out that designing a ui and really thinking about how it would work from the user's perspective is just as important as coding it. If you have any ideas about how this would work, they aren't any less valuable than time spent working on these boosters.

I will post my ideas on this tomorrow, but I will just say for now that I think it would function like foldit, only that instead of your score going up, you're number of designs will go up.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Example of Experimental Plan

I'm attempting making an experimental plan that allows for running several hypothesis against a starter set of designs.

I am wondering if 15 designs against 15 designs are enough to gather reliable enough data for a comparison? Probably not.


Exclusion lab

I have tried structure it, so I can run two different aptamer positions in relation to MS2, in an exclusion lab (can be done for other than fmn labs). Then I would make two different sets, where one would have 1 long static stem and the other set would have two shorter static stems.

I would also like to test sets with if GU are present in the aptamer gate or not. Aptamer gate - the stem forming at the switching end of the aptamer, when the aptamer is bound to the molecule. This is to test that GU's are quite helpful in the aptamer gate - which I suspect.


Plan for 120 designs




All in all 4 experiments, testing 4 sets of hypothesis.

4 hypothesis, 4 pairs of 15 against 15 designs. Or 120 designs. For the GU test I would have 60 designs against 60.

However it may be better doing one less hypothesis but have space for more designs and getting better data. Silly me wishing for more slots. ;)


Alternative plan with 80 designs

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Thank you, @Eli.  It's good to have a concrete example to discuss.

I think I understand your experimental plan, and it looks quite feasible if you are doing it yourself.  But my guess is that if one wants to recruit lots of players to contribute designs, it would help to break down an experimental plan into multiple, simpler experiments.

For example, in the case of your 120 design plan, you have three experimental variables -- aptamer, distance between aptamer and MS2, and presence/absence of GU pairs, resulting in your 8 boxes.  I suspect trying to analyze the data coming from independent submissions from multiple players who may not really understand your intent would be a nightmare.

What if you were to frame your plan as multiple individual experiments, each experiment consisting of just one puzzle (which would fix the aptamer) and one MS2 position, which you (plural, i.e. core group) pre-determined, along with providing a set of starting solutions that lack GU pairss.  You could then present the role of an individual contributor to be choosing a starting puzzle, creating one or more designs with one or more mutations to create GU pairs, and then perhaps do an additional mutation in a static part of the puzzle if it turns out if the sequence is rejected because someone else has already submitted it.

That seems like that might be more manageable, both for individual contributors and for the later analysis.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
@Omei, thx for your feedback. 

"I suspect trying to analyze the data coming from independent submissions from multiple players who may not really understand your intent would be a nightmare."


I am certain you are quite right. 

My experience from round 101 was that the more and smaller experiment sets were, the more pain the analysis. 

Also it is a great work around to mutate in the static region of the puzzle if the design a player wants to submit is already submitted.


Multiple Individual Experiments

Let me see if I get what you are proposing and let me try again. Ok so instead of multiple variables tested against each other on individual player basis, we could start off with an experiment design series based on the same starter design. Or it could be considered set zero.


1) Generate Experiment starter design

2) Create series on that starter design. 

This could be considered first experimental set that one player could post.

3) Split the variables out so one player only get one. 

4) Several different set of hypothesis could be run again the first design set. Each hypothesis will in itself be a new experiment and a set of designs to submit for a player. 


An Experiment design starter example

Since examples are helpful, I have created a an experiment example starter design. I based it in the CRISPR/CAS FMN 1a Exclusion lab.




Experiment 1 - GU or not in in aptamer gate 

Basically only one variable change. Namely the GU content. 


1a) Set 0

  • MS2 before the second aptamer sequence  #ms2a2
  • One long static stem  #StaticStem1
  • One GU pair in the aptamer gate  #GU+

1b)

  • MS2 before the second aptamer sequence  #ms2a2
  • One long static stem  #StaticStem1
  • No GU in aptamer gate  #GU-

Each of these subsets of the experiments could be done by each a player. So something like 100 designs per set, or they could be run by the same player. (50+50 slots)

That is one hypothesis tested.

However it is possible to test more in the same go.


Experiment 2 - Deleting the turnoff sequence

From round 101 I saw that deleting the turnoff sequence, killed the switch score. (for turnoff sequence - see the image - its the sequence that takes turn to turnoff FMN and MS2.

I had a small set of designs confirming this. However I think it will be valuable confirming in bigger numbers, as it is proof of function for that sequence stretch.

2a) Set 0

  • MS2 before the second aptamer sequence  #ms2a2
  • One long static stem  #StaticStem1
  • One GU pair in the aptamer gate  #GU+

2b)

  • MS2 before the second aptamer sequence  #ms2a2
  • One long static stem  #StaticStem1
  • One GU pair in the aptamer gate  #GU+
  • Delete the pyrimidine stretch of C's and U's, before the MS2  #TurnoffDeletion
Only one variable change - deletion of the TurnoffSequence. And yet a experiment set to make for a player



Remaking of hashtags for specifying order of MS2 to aptamer sequence

I will need to reconsider some of my new hashtags. Something weird happens with my naming of puzzles. I think I have found a lab bug. 

1) On the lab page the design name is far longer.


2) When viewing the design in the game, everything in the title after "<" dissappears.
(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
This seems to me like a big improvement in focus, @Eli.

But now let me bring up another issue, and that is generalizability.  Let's consider the hypothesis you want to test to be "One or more GUs in the aptamer gate correlates with higher fold change".  That's a general statement, with no restrictions on what aptamer, or what kind of gate it is, or what the reporter is, or what the other aspects of the switch are, etc.

Suppose you were to collect all your data for this hypothesis on variations of the one starter design you you showed above, and they confirmed your hypothesis.  Would this be evidence that the general statement above was true?  Or would it be evidence that for this specific combination of aptamer, aptamer gate, reporter, blah blah blah, it was true?  More the latter than the former, which would be kind of disappointing. The issue is that showing a statistically significant effect in an experiment relevant to one specific switch pattern is not nearly as scientifically significant as one that is generalizable to a broad class of switch patterns.

So I'm thinking your next step should be to decide how broad a class you think you want to generalize this hypothesis to, and then try creating a set of starter puzzles that together is representative of the broader class as a whole.  Obviously, the broader the class you want to generalize to, the more starter puzzles you need to form a representative set.

I suspect you were intuitively thinking along these lines when you drew out a complete matrix of test conditions, and you may actually end up with a set of starter designs similar to the ones you would have created for that matrix.  The advantage will be that your experiment will be more focused on testing one hypothesis well, as opposed to testing many hypotheses at the same time, and ending up with data that is insufficient to convincingly answer any.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Omei, thanks for your guidance!


I will try to focus the hypothesis.


“But now let me bring up another issue, and that is generalizability.  Let's consider the hypothesis you want to test to be "One or more GUs in the aptamer gate correlates with higher fold change".  That's a general statement, with no restrictions on what aptamer, or what kind of gate it is, or what the reporter is, or what the other aspects of the switch are, etc.”


The lack of restrictions on what aptamer, aptamer gate and reporter is because I wish to test if it is general to all switches in the whole round (plus future switch elements), also the new ones we have no data on. No matter what their aptamer, reporter and lab type.


Lesson 1: Make a hypothesis that is universal enough that it can be tested on a huge set of different different labs. Not just in one single lab.


This will reveal the bigger view of what is on the puzzle. A single lab only provides a smaller piece of the puzzle. Specifically is only one possible setting of the puzzle is tested.


“Suppose you were to collect all your data for this hypothesis on variations of the one starter design you showed above, and they confirmed your hypothesis.  Would this be evidence that the general statement above was true?  


Rethorical question. :) Answer is of cause no.


I did only one Experiment demo puzzle, in an Exclusion lab and with a specific aptamer (FMN) and reporter (MS2), at one specific stem at a specific place in relation to the aptamer. And in particular, I was focusing on only a single spot.

I had a reason for that, but I now see it is not good enough. See the later section: What I really want to test.


"Or would it be evidence that for this specific combination of aptamer, aptamer gate, reporter, blah blah blah, it was true? "


Rethorical question. :) The answer is of cause yes.


“More the latter than the former, which would be kind of disappointing. The issue is that showing a statistically significant effect in an experiment relevant to one specific switch pattern is not nearly as scientifically significant as one that is generalizable to a broad class of switch patterns.””


I was aiming for detail precision but would miss out on the big picture.That would give me an answer about what is on a microdot on a huge image. While I had planed to do the same on the rest of the labs, it would still only give me spread out microdots of a small part of the full picture.

Lesson 2: Test your hypothesis not just in one specific type of solve in a lab puzzle, but test it in a wide array of settings of that puzzles. And do the same for other labs.



What I really want to test


I wish to know if GU’s positioned in the switching area are beneficial to help the switch get switching easier. Something that jandersonlee suspected and I think too.


What I really want to test is the usefulness of GU’s in the whole switching area and across states and in a huge amount of different puzzles. That GU's seems beneficial is an old observation that I did in our early switches, where the main part of our first few winners disproportionately had a GU in their switching area.


All this I thought harder to test. Hence the focus on a single GU pair at a single spot in a single specific state. I thought this would be easier to test.


Background posts


GU-pairs in switch designs

Use of GU in two input labs

Also I seen GUs being helpful in the XOR labs. A good deal of winners even had crossed GU's inside long stems that needed to get switching.

Crossed GU’s are now legit :)

Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
My idea of it is, very similiarly to Jason's tools, a foldit toolbar with buttons like "Mutate bases", "Move MS2", "Insert/Remove Buldges", "Mutate MS2" (change to another valid MS2 sequence), etc. As you go on it will generate more sequences, and will have a counter for how many you have, similiarly to foldit's score. When you click on any of them, it will print it to the applet, and there you will be able to edit it, and then replace the old, create a new one with your mutations, or simply remove it from the list.

You will be able to filter them via basic filters (base 50-65 matches the RY pattern you provide, Includes a specific sequence, etc.), or create your own (It's very basic scritpitng, so even in an in-game textbox).

I think of 2 more types of scripts:
1) Custom mutation (e.g- add a buldge of size 2, change a random A to G).
2) Series of mutations (e.g- mutate a random base -> Remove/Add a buldge -> maybe move the MS2 one base -> repeat). I do think the 2 types should be seperate, as that will allow type 2 to have a very simple graphical editor (with dropdowns for every type 1 script), but I'm not totally sure on that
one. We will have to plan more in order to decide.

Maybe type '1)' (and by extention type '2)') scripts could accept filters? For example Mutate the MS2 only to MS2 following the Strong/Strong/Weak ending (per eternac's comment here

Also, some questions:
  • Does a query to submit a lab currently exist? If not I doubt it matters for now as for prototyping / early gathering a firebase server could be set up for now.
  • You said that we can get 100k designs with this setup. However, do you think that duplication of designs won't be a problem? Especially if a lot of players start with the same sequence. Maybe we should use more than 24 versions of the MS2?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
"Mutate MS2" (change to another valid MS2 sequence"

MasterStormer, I in particular like this option. We lack the option to mutate on the full set of MS2's. I think it will be very valuable. Even if most won't be stable, getting those that are in fast and then in one go delete the unstable ones, would be really helpful and ensure that more of the alternative MS2's gets tested to a more full extent.

On the dublicate part, the design will get rejected if the sequence is already submitted to lab.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Re your questions:
  1. Does a query to submit a lab currently exist? No.  But I should be able to create a script that does that, which any other script can then call.
  2. Duplicating designs when multiple players are trying to contribute to the same focused experiment will definitely be an issue, and not specific to MS2 sequences. As Eli pointed out, the submission process will reject duplicates, but having that happen often would be a disincentive for the player.  My general thoughts are that for a focused experiment, part of the experiment's design should be the designation of some set of bases as being available for mutations that aren't expected to significantly affect the fold change.  Typically, I think this would be part of a static stem where flipping a base pair would not be expected to make any difference in the partition function. How that would actually be implemented, from the players' point of view, is an open question.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
One hypothesis - multiple experiments


So I give it another go trying to set up an experiment plan.


Hypothesis: Are GU in switching area helpful or harmful to the switching ability of an RNA switch?


1a)  One static stem, MS2 before second aptamer, with GU

1b)  One static stem, MS2 before second aptamer, without GU


2a)  One static stem, first aptamer sequence before MS2, with GU

2b)  One static stem, first aptamer sequence before MS2, without GU


3a)  Two static stems, MS2 before second aptamer, with GU

3b)  Two static stem, MS2 before second aptamer, without GU


4a)  Two static stem, first aptamer sequence before MS2, with GU

4b)  Two static stem, first aptamer sequence before MS2, without GU



One hypothesis - potentially more insights gained


Things that could also be interesting to look out for related to this GU is beneficial in the switching area hypothesis:


  • On and OFF states may not benefit equally from a GU addition.

  • Exclusion and Same state designs may not benefit equally either.

  • Also in designs that holds a rotated aptamer, the rotated aptamer provokes a different solving style, GU’s may work different in there too.

  • Different states may differ in their need for GU’s.


However my suspicion that GU’s are a help to prepare a switching stem for switching and help it swap states. Not all GU’s everywhere in the switching area are expected to help. Some will worsen things.





Running the experiments



This could be run several ways:


  1. One player could generate all the necessary designs much like in my Experiment plan and giving each design type 15 designs. (8x15=120)

  2. By several players doing as player one, but following the same template

  3. By giving each a set to different individual players.



Advantages and disadvantages


I have tried sum up what I think may be advantages and disadvantages of each option.


1)


Disadvantage: Although one is testing only one hypothesis, but in 8 different settings, one is still not generating many designs for comparison.


Disadvantage: It takes more work


Advantage: One can get started immediately and others can tag along.



2)


Disadvantage: It takes more work for the individual player to generate 8 set of puzzles - even if over 8 design starter templates, than just generating a ton of mutations in single experiment set based on 1 starter template and one fixed variable.


Advantage:  If one player misunderstands the task, the other players can still make good use of the data they generated as one whole set won’t be missing.


Advantage of option two for now. We can get started generating experiments now and have others follow when they are ready.



3)


Disadvantage: Can only be run properly with many players working together.


Future advantage: If there are many players participating in the experimentation, this will be the best option. As one can have several players run the same set then we should not be as prone to missing out on a full set.  

(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@MasterStormer Do you have an example booster that overlays the flash UI?  I'm interested in seeing how robust the positioning is.
Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
The positioning is the problematic part, as zooming makes it uncalculatable (I am pretty sure)... I have a prototype called remove all markers, but I didn't yet calculate it's positioning, so it's just thrown on the left. However I know Andrew had over half of it below the screen in 125% zoom
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Thinking aloud...

I think I need to double the set I proposed, so I test both Exclusion and Same state.

What would be best if one could test both puzzle sets at the exact same conditions. So do the same experiments to both lab types. Well knowing that some of the design types will be futile. 

The first 4 experiments I proposed are good for exclusion, but not for same state puzzles. While I could make them without big trouble. These next four sets are good for Same state but not Exclusion.



Same State

5a) One static stem at late position, ms2 distanced to aptamer, with GU

5b) One static stem at late position, ms2 distanced to aptamer, without GU


6a) One static stem at early position, ms2 distanced to aptamer, with GU

6b) One static stem at early position, ms2 distanced to aptamer, without GU


7a)  Two static stems, MS2 distanced to aptamer, with GU

7b)  Two static stems, MS2 distanced to aptamer, without GU


I'm not really able to double the last task for Same state labs. Unless I do one lab where I put the static stems next to the MS2 and another where I put them next to the aptamer gate.

The Same State lab works typically by a double sequence pairing between the MS2 and the aptamer or aptamer gate. Whereas Exclusion work by a nearby turnoff sequence.


Exclusion


5a) One static stem, ms2 distanced to aptamer, turnoff sequence before ms2, with GU

5b) One static stem, ms2 distanced to aptamer, turnoff sequence before ms2, without GU


6a) One static stem, ms2 distanced to aptamer, ms2 before turnoff sequence, with GU

6b) One static stem, ms2 distanced to aptamer, ms2 before turnoff sequence, without GU


7a)  Two static stems, ms2 distanced to aptamer, turnoff sequence before ms2, with GU

7b)  Two static stems, ms2 distanced to aptamer, turnoff sequence before ms2, without GU


8a)  Two static stems, ms2 distanced to aptamer, turnoff sequence before ms2, with GU

8b)  Two static stems, ms2 distanced to aptamer, turnoff sequence before ms2, without GU


Conundrum

These two late sets won't be the same, as I'm not giving the Same state labs a turnoff sequence, and I'm not giving Exclusion a double sequence pairing between ms2 and the aptamer/aptamer gate. While I know both will likely do ugly, the above is not completely comparable tests between two switch type labs. 





Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I have been thinking further.


Same State Experiment Set

I wish for two of each puzzle settings, one of them with GU in the switching area and one of them without. So two set of each 8 puzzles. For same state I'm primarely interested in the last 4 as these are the typical same state types. But I'm kind of want a comparison with exclusion lab

  • 1 static stem, ms2 next to second aptamer sequence
  • 1 static stem, ms2 next to first aptamer sequence
  • 2 static stem, ms2 next to second aptamer sequence
  • 2 static stem, ms2 next to first aptamer sequence
  • 1 static stem, ms2 distanced to aptamer,
  • 1 static stem, ms2 distanced to aptamer,
  • 2 static stem, ms2 distanced to aptamer
  • 2 static stem, ms2 distanced to aptamer
Generally I like the static stem next to the aptamer gate. But that bit can be varied. I'm imagine a series of each puzzle type where things like static stem position is varied, multiloop loop size is varied and the position of the MS2 is slightly varied.


Exclusion Experiment set

For the exclusion set I'm primarely interested in the first 4 as these are typical in exclusion solves.

  • 1 static stem, ms2 next to second aptamer sequence, turnoff sequence before ms2
  • 1 static stem, ms2 next to first aptamer sequence, turnoff sequence after ms2
  • 2 static stem, ms2 next to second aptamer sequence, turnoff sequence before ms2
  • 2 static stem, ms2 next to first aptamer sequence, turnoff sequence after ms2
  • 1 static stem, ms2 distanced to aptamer, static stem late, turnoff sequence before ms2
  • 1 static stem, ms2 distanced to aptamer, static stem early, turnoff sequence after ms2
  • 2 static stem, ms2 distanced to aptamer, turnoff sequence before ms2
  • 2 static stem, ms2 distanced to aptamer, turnoff sequence after ms2


What to do next?

Now my problem is that the Same State Experiment Set and the Exclusion Experiment set are not really the same anyway, despite the similar solve set up.

Since the Exclusion type uses a turnoff sequence right after the MS2, something that Same State solves do not.

So to get a full comparison between the labs, I would have to run two set of 16 puzzles each for each lab. So I'm considering if it is worth it or it gets too complicated. I mean rather a double set of 4 puzzles that we get good data on, that a double set of 16 that are comparable across labs, but we get little data on.

Also I wonder if it is a good idea calling the experiments things like 1a and 1b etc, since the labs are already called something similar. Perhaps 1x and 1y would make more sense?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Also I have tried figure how to put up the comming data in a spreadsheet. I have two different settings below. The first one where I have both double sets of 8 grouped together.

The second one where I have the split the sets after if they got GU in the switching area or not. So they are kind of prepared for plotting in the average fold change and max fold change for the sets. Also I would need a way to pull those sets afterwards. I would kind of need to pull more hashtags at the same time and I'm wondering if this is going to give me trouble.


Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
An Experimental Template

I have been thinking further about making an experimental plan. I want to set it up in the simplest way possible. 

The plan is to end up with something that will make it easy for you to copy my experiment template or adjust it to what you need, so you can afterwards stick your experimental data into Omei's data analysis template and see if your hypothesis is confirmed or not. 

  • I do 4 different experiments in each lab. (Two will be fine too) These experiments I will repeat across all labs.
  • The experiments will be fitted to if it is an Exclusion lab or a Same State lab. I will use design setup that had shown themselves to work there.
  • Each experiment will have two puzzles series with close to identical designs. One puzzle series without the specific feature you wish to test and the other with. In my case a GU in the switching area. 4 puzzle series with GU and 4 puzzle series without. So this make 8 series of puzzles in each lab.
  • I will as far as possible attempt to make the design with GU and the design without GU identical. (May have to change a base in a less important spot if the design I intended is already taken, or in some cases if I can't make a stable version of either the one with GU or the one without)
  • I will distribute 120 slots to each lab for these experiments. That will give me 15 designs in each experiment category. And I will still have 30 slots left to do funny but suspected useful mirror, double and triple aptamer experiments with. :)

The test outcome


The main variable in my entire experiment is GU. If the fold change between the set without the GU and the set with GU in the switching area differs considerably, then the variable I'm testing is having an effect. Since it is the only thing that is really different. 

My hypothesis is that GU are helpful in the switching area. But if I instead put it as a question, it is simpler to see the outcome. 

Question: Are GU in switching area helpful or harmful to the switching ability of an RNA switch?


Lab conclusion

In reality I can end with 2 or really 3 different answers to the question in my hypothesis. 
  • Yes, GU is really helping in the switching area
  • No, GU in the switching area makes everything worse 
  • Nah, there really is no fold change difference between designs with GU in the switching area or not. Try a new hypothesis. :)


How to analyse the data when it comes back

Here is how I plan to use Omei's analysis template to compare my results.  


Omei's Data Template

  • I will pool all the a-series together afterwards to compare all the b-series designs. This part of the work will be easiest doing in a spreadsheet. This I will do for each lab. That way I get to compare 60 designs with GU to compare with 60 designs without GU. Those two sets of 60 designs will be near identical except for the GU content.
  • Then I will likely pool all the Same state designs in two sets and all the Exclusion designs in two sets and see if there are different trends for these two lab types. It may be that GU in the switching area is helping Exclusion designs more than in Same state designs, etc. 


My Experiment Plan


There will be an identical b-experiment for each a-experiment, just without GU in the switching area. 



Exclusion Set


1a)  One static stem, MS2 before second aptamer


2a)  One static stem, first aptamer sequence before MS2


3a)  Two static stems, MS2 before second aptamer


4a)  Two static stem, first aptamer sequence before MS2




Same State



5a) One static stem at late position, ms2 distanced to aptamer


6a) One static stem at early position, ms2 distanced to aptamer


7a)  Two static stems, MS2 distanced to aptamer, static stems near MS2


8a)  Two static stems, MS2 distanced to aptamer, static stems near aptamer gate


I only make one experiment template but I will repeat it across all the labs. So when you have first decided what to test and how, everything will be far easier from there. 

You could use the same basic switch element position as in my puzzles, but test a different thing than GU. Or choose a different puzzle setup but still test for GU. Its fully up to what you can imagine, you wish to test. Also there are plenty of ideas here.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I figured how to call all the A experiments in one go. Instead of calling experiments like 1a, 2a, 3a etc and then trying to figure how to pool them. I can call them Experiment A1, Experiment A2 etc. That way I can search for Experiment A.... and I will get them all in one go in a lab or even across labs.
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
I am assuming "bulkloader" allows you to upload many solution into the lab designs.
There is also talks of mutation scripts. Coding is difficult enough without doing too much in one script.
Any scripts that:
1) only do "bulkload".
2.)only look for valid mutations from a given valid sequence
I am really only interested in #2 at this time since I have submitted enough labs to get an idea of where I want to go. What's the best existing script that comes closest to #2 for any lab so I can modify it? 
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
I think jandersonlee's BulkLoader v4 (devops) booster best fits your #2 requirement. Despite its name "bulkloader", it doesn't actually submit designs in bulk.  One of the things it can do, though, is generate a lot of different kinds of mutations and evaluate each for whether it meets all puzzle criteria (with the currently selected folding engine.)  It keeps track of those that don't as well as those that do, but all you have to do to remove the ones that don't meet all the criteria is to click on the "Purge" button.

To submit the remaining "valid" designs, you need to use the Next and Previous buttons to load the designs into the game UI one by one, submitting each one from the UI as you would normally.
Photo of cynwulf28

cynwulf28

  • 80 Posts
  • 22 Reply Likes
   I have a question/suggestion.

      In the "New Progression" there is a tool called Eterna Bot which works to generate a score based on what is thought to be a favorable lab design. I recall that the increase in Eterna Bot score corresponded well with what has worked well in the recent labs and so I was curious as to why Eterna Bot isn't available as a tool/feature in any of the Lab rounds I have seen.
  One thought was that Eterna Bot couldn't handle switches as a whole, but each switch has a single-state component and I would think that Eterna Bot could handle those. 

     If Eterna Bot doesn't have any issue scoring switches, then I would like to see this made into an available tool, similar to Melting Curves and Pairing Probability Plots as yet another aid to improve lab designs.

  
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
That version of Eternabot (essentially) attempts to find a sequence that makes the target structure as stable as possible, which implies trying to eliminate the possibility of alternative foldings.  That's not good for making a switch.  For a switch, you want to have 2+ foldings that are close enough in energy that the presence or absence of the input(s) controls which structure forms.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Since this is kind of our during experimenting forum post, I decided to stick some of my current lab musings in here too.


Making great switches switchier



What switches want

1)  Most of all symmetry
 
2)  Double aptamers (Ok, probably not all labs want them - but the riboswitch designs with best fold changes have them.)


Getting some more symmetry into Exclusion labs

I have been thinking about how to get some more symmetry stuck into our past not so symmetric solves of Exclusion lab puzzles. 

Till now our Exclusion labs have been less symmetrical than our same state labs. Due to the MS2 liking to be directly next to the aptamer, it does a skewed pull. Not like the more straight pull between MS2 and aptamer in the Same state designs. 

I think I have found a way around this. 

I did a solve where I doubled what have worked in a past Exclusion NG 2 winner.


http://www.eternagame.org/game/browse/8047736/?filter1=Id&filter1_arg2=8143991&filter1_arg1=...

Ignore the #alternativems2 bit, both MS2's are true MS2's.


Blueprint addition by rotation

I like to talk about a riboswitch blueprint - which is really just a template of how the switch elements prefer to be placed in relation to each other.

There is one for Same state labs (ms2 distanced to aptamer) and one for Exclusion labs. (ms2 next to aptamer)

A thing that has worked earlier for me is to add up blueprints. Like take two different working versions of a design and add the structure of them together to get to a new structure with a shot of working. This time I rotated the blueprint 180 degrees instead.



https://drive.google.com/open?id=0BxJGPGrJ3fkKRlhCZlpYTkFzak0


 
Ultimate Symmetry


I have made a new Exclusion series called Ultimate symmetry which has: 

1) Lots of symmetry

2) Double aptamers

3) Double MS2 (will often be alternative MS2's.)

 

https://drive.google.com/open?id=0BxJGPGrJ3fkKcWFRWUNVcnI3Zkk


What may we learn?

Not all designs will benefit equally from having double aptamer or double MS2. I think it will all depend on the balance of strength between aptamer and switch hairpin. (MS2, K4 - kissing loop hairpin etc.)

Basically varying the number of aptamers in relation to MS2's in labs with different aptamers are a way to probe the strength of the aptamer versus MS2. I suspect that some of our new aptamers will take more work opening compared to the FMN we have worked with so long. These may benefit from having one aptamer against 2 MS2's. (At least in Same State labs)

In our past FMN/MS2 labs, two FMN countering MS2 worked real sweet. Two FMN versus one MS2 are in are in balance in the Same State NG2 lab.


Future wishes


What I wish for next round. Even bigger switch bubbles. :)

Basically a switch bubble big enough to stick 4 ms2's into and leave room for a small loop sequence between them. I would like to see if I could make an exclusion design work that way with 4 MS2's against one aptamer. I suspect the MS2's may help the aptamer do its job, because they may also be able to switch each other off.

The lack of a big enough switch bubble didn't stop me from trying though.

I went fibonacchi on the MS2 ON control freestyle puzzle. :)

Which really stems back to a beautiful idea that Zama brought up. She asked me if RNA could be fibonacchi like.

Since I had already planned to try stick in 4 MS2's in somewhere and static RNA literally hates too much symmetry and too similar elements, I decided to instead of spreading the MS2's in an even way, to spread them in a growing or decreasing order. Aka fibonacchi like.

So Fibonacchi helps add in asymmetry, yet in a systematic way. Alternative MS2 add in sequence variance in the otherwise identical elements elements.

Hereby Zama's idea is passed on. Go get creative. :)
Photo of Gerry Smith

Gerry Smith

  • 63 Posts
  • 29 Reply Likes

Is there a way to find designs that almost have qualities (such as those Eli has highlighted) and bring them to attention to eterna’s top designers for targeted alteration? 

Creating (puzzle) games within a (active lab) game?

Combining design insights with our group’s designing skills?

   
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Ok, I can actually get my structure from lower in the script.

[{"type":"oligo","oligo_sequence":"GCGUCUCAUCUUUAUGCGUC","oligo_concentration":1e-16,"oligo_name":"Target DNA","oligo_label":"T","secstruct":"(((((((((((((((((((((((((((.((((.....................................................................................))))...)))))))..((.....)).......((((....))))(((((((...)))))))....&))))))))))))))))))))","structure_constrained_bases":[21,31,117,129],"anti_structure_constrained_bases":[32,43,106,116],"anti_secstruct":"................................(((......(((..............................................................))).....)))................((.....)).......((((....))))(((((((...)))))))....&...................."},{"type":"aptamer+oligo","fold_version":2,"site":[34,35,36,37,38,39,40,41,108,109,110,111,112,113,114],"concentration":2370,"oligo_sequence":"GCGUCUCAUCUUUAUGCGUC","oligo_concentration":1e-16,"oligo_name":"Target DNA","oligo_label":"T","secstruct":"(((((((((((((((((((((((((((.(((((((......(((..............................................................))).....)))))))...)))))))..((.....)).......((((....))))(((((((...)))))))....&))))))))))))))))))))","structure_constrained_bases":[21,43,106,129]}]"

State 1: (((((((.((((.....................................................................................))))...)))))))
State 2: (((((((.(((((((......(((..............................................................))).....)))))))...)))))))

(after I delete the first 20 bases and the bases after 130)

Here is the sequence I cut out from my original puzzle:
GUUUGAGAGCUACAGAGGAUAUACAUGAGCAUCAGCCAUGUAGAAGGCUGACAAUAAGUCAGAGGAUAUACAUGAGGAUCACCCAUGUAGAAGGCUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

Using the Copy/Paste/Replace booster (Introduction here)

However due to my puzzle being a monster with two MS2's and two aptamers, I have trouble stabilizing it, even after adding in an aptamer molecule.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
How my puzzle looks in the puzzlemaker after the operation. Dead unstable.



While it has the structure of the original puzzle.

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@eli I'm not that conversant with the puzzle maker.  But if I enter the following two structures:
(((((((((((((((((((((((((((.((((.....................................................................................))))...)))))))..((.....)).......((((....))))(((((((...))))))).....))))))))))))))))))))
and
(((((((((((((((((((((((((((.(((((((......(((..............................................................))).....)))))))...)))))))..((.....)).......((((....))))(((((((...)))))))......)))))))))))))))))))
and assign the bonus to the appropriate loop, I see

which seems like the right structure for you.  If you fill in the proper bases and it doesn't behave the way you expect, things may just not work the way I think they do.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Thx Omei, for thinking about this workaround.

Unfortunately puzzle maker do not agree. I got the sequence and guide DNA sequence added. My puzzle is still unstable.

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
"Unstable", as commonly used by players, simply means that the folding engine's calculation of MFE for the sequence doesn't match the target structure.  I may be missing your point, but can you resolve your problem by simply adjusting the target structure to match the predicted folding?  It looks like you took my target structures as gospel, instead of just being a model for the locked bases.
(Edited)
Photo of Gerry Smith

Gerry Smith

  • 63 Posts
  • 29 Reply Likes
I want to share one insight that came from another game I play (Quantum Moves - simulates moving atoms with laser tweezers)....the power of dropping bias.

The easiest way I have found to find bias is just to observe my own tendencies and then ask if these are in concert with the project's objectives.  If they are not, then that tendency (which is also highly likely to be held by others) is a bias to drop.

Here is an example.  Quantum Moves has 23 game levels - each simulating some aspect of quantum physics quandaries of quickly and stably moving atoms.  I noticed that I had a desire to get a top score in at least one of these levels.  So I had a tendency to focus on one game or a certain group of games where I thought I had a better chance of getting a top score.

Since each level incorporated different aspects of quantum physics aspects, not learning about the aspects of other game levels was not in concert with the project's goal.  Therefore the tendency to want to win at one level was a bias against cross level learning.

To remove this bias, I simply shifted my goal of wanting to get a highest score in a game to improving my worst score of all games.  This put my efforts more in alignment with the project's goals (of improvement) and also gave me two advantages that other players did not have.

The first advantage was better cross level learning.  By always focusing on my worse game, I improved the simulated quantum physics aspect that I was worst at.  And then could apply that to other games.

The second and probably more powerful advantage was to create better motivation for sustained engagement.  It was both easier to play this way, less frustrating and more fun.  So I played much more than other players.  

As a result of dropping this one bias, and after a year of playing in spite of the fact that I had never played any computer games before, I now have the top scores in Quantum Moves in 18 of the 23 levels, including all levels from 9 and up and being in the top 5 in the other five lower levels.

In eterna, the bias I have noticed within myself is to want to do the games myself without help to prove that I can.  In the lab, this has translated to a feeling wanting to create my own designs.

I assume others feel the same way.

This prevents cross person design collaboration during the most important time (labs).

How do we drop that?

 
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Hi Gerry Smith!

I found your observations interesting. I think you have some real good insights here.

"Therefore the tendency to want to win at one level was a bias against cross level learning."

You are absolutely correct. To learn what will potentially work in future labs, we have to be willing to take a loss on score. It is helping in the EteRNA world that we haven't been getting lab coins for our designs for a long time.

The real game is figuring out how RNA folds. What it prefers.

If we can predict what it wants, we can help scientists make better tools for solving real world problems. 

You shifted your focus by will, to learn to overall improve your skills.

You did something else. You choose to improve your skills compared to yourself, which is really the best measure stick there is.

If we shift our focus to that there are people out there who are ill and that we actually hold it in our power to do something about it, I think it will be easier to drop the less healthy competition part. Which isn't good for us either.

We are not winning this game for ourselves. We are really trying to win this game for humanity.
(Edited)
Photo of Gerry Smith

Gerry Smith

  • 63 Posts
  • 29 Reply Likes

Mutation Tool - improving player-oriented efficiency

I have been using Nupack less in Lab because the engine is both slower to run and process submissions.   Awareness of that bias has me looking for what unique Nupack engine values I may be overlooking.

Both @Zama and I have noticed that when running the mutation tool on TEP designs (which we favor Vienna 2) our hit rates for multiple engine designs was low.  When looking for what wasn’t working I noticed that it was often a stem within Target mode, State 2 of Nupack.

So instead of just fixing the aptamer and running my TEP designs thru Mutation, I also fixed combination of nt’s are were more successful for this stem within Nupack first.  And then my multiple engine hit rate increases significantly....which hopefully improves Lab submissions!?

Other potential ways of improving Mutation tool efficiency is selecting designs within design similarity proximity of attractive characteristics.  Such as symmetry (@Eli Fisker), minimal cross-engine nt movement (@Zanna) and/or fixing attractive design elements such as FMN aptamer orientation.

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
This is an interesting question.  To the best of my knowledge, no one has actually done an analysis of lab results to see what predictive value there is in knowing which engines approve of a design. It's certainly not for lack of data; we have plenty of data for the FMN/MS2 input/output combination. It would definitely be a very valuable thing to know.

I have too many ongoing commitments to take an active role in a project like that right now, but I could certainly help guide you to the relevant data/resources if you (or anyone else) wanted to pursue that.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Do the static stem in the switching area have a function?

Back in the early Riboswitch labs I made an observation that a static stem would turn up in a huge amount of the winners. I started to speculate about that the static stem was necessary. That it had a function on its own.

For background see the section No Static Stem.

Particularly in the Exclusion NG 2 lab did this stand out. In our lastest riboswitch lab (101), roughly 95% of all the winners have the static stem right next to the aptamer gate.


http://www.eternagame.org/game/browse/6369184/?filter1_arg1=6456051&filter1=Id&filter1_arg2=...

I ended up doing some experiments, where the space for the static stem got deleted. All designs I did this to across labs, ended up with a lower score than the original designs except in one case.

Here are the two small loop labs that are equivalent to the Exclusion NG 2 lab. All these designs are based on winning Exclusion NG 2 designs, but without space for and the sequence of the static stem. They all took a score hit.




 

Omei's insight + mine = Is the Static Stem in the switching area doing Coaxial stacking?

What I'm really interested in now is getting something specific tested.

Omei has earlier brougth up that stems when being next to a sequence that would bind up with an outside input, were doing coaxial stacking and helping the input bind with the sequence next to the
static stem.

Intro to flush stacking energy

I have started to wonder if not the static stem in the switching area of a riboswitch, when next to the aptamer or MS2 is doing coaxial stacking.

Combining these two ideas

1) Static stems are (often) necessary in the switching area
2) A coaxial stacking aids the binding of the sequence next to it

And it would pretty much make sense that static stems do have a function.

Static stems seem necessary at specific spots and those specific spots are somewhere where coaxial stacking will help the fold.



Potentially allowing for a coaxial stacking of the static stem with the aptamer gate and as such potentially aiding the bind of the FMN molecule.


The Nature of Static Stems

I basically think static stems are a bit like mushrooms. If there are enough bare soil, more will pop up. So if there are excess bases not in use or needed for the switching area itself, a static stem will come in handy.

If there aren't excess bases, a static stem isn't needed. If there are lots of excess bases, more static stems are needed.

I also think that if there is space for two shorter static stems, that they will be better than one real long static. Basically RNA seems to not be too happy about all too long stems. Unless some GU or mismatches are stuck into them. Also if coaxial stacking is occouring, then two static stems would mean two energy bonuses. :)


Additional experiment proposals

While I have gotten closer to have my experimental starter designs put up, I realized that in some labs, the aptamer took so much place or the switch elements were placed in such a way, that I can only run 1 out of 4 experiments. Thus I have 90 slots to spend for other experiments.

What I'm thinking of is to use them on a design with 1 static stem. And do something like change the position of the static stem, so it in 30 designs will be next to the aptamer gate, in 30 be next to the MS2 and in the last 30 be inbetween.

It could also be interesting having frequency experiments where the static stem gradually gets moved between being next to the aptamer gate to being next to the MS2. In a systematic manner. Like the ones Omei has done and I show in this intro to using eterna spreadsheets.

In particular in the CRISPR/FMN NG labs, this should be interesting to test as we can literally stick in past winners. And then move around the static stem.

Get creative... :)
(Edited)
Photo of Gerry Smith

Gerry Smith

  • 63 Posts
  • 29 Reply Likes
Despite increase in hangups, I want to give huge kudos to developers of mutation tool.  Without a doubt it has vastly increased my value as a lab participant in being able to quickly explore many unknown areas and finding designs with multiple engine hits.  Makes it so much more fun to be able to look for interesting patterns and explore further. 
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Ultimate Symmetry Continued


My Ultimate Symmetry series in Exclusion labs holds double aptamers.


I put in rotated aptamers with the intention of getting the aptamers turning their favorite orientation towards the switching area.


However I have realised there may be a tiny problem... :)


Namely that if the aptamers are placed like this and the rest of the puzzle scaffold are not strong enough to hold the aptamers, the following may happen.


Rotated aptamers


https://drive.google.com/open?id=0B55atkAMoafyVEE0eUxpM1BTWXc


  • The aptamers may stay ON in both states.

  • The aptamers may instead of shutting off, find each other's matching FMN half, do an aptamer rescue mission, so both the aptamers will stay turned ON.


I have earlier called the kind of aptamers for mirror aptamers. But really the extra aptamer I added is rotated 180 degrees in relation to the locked aptamer.


Sameturning aptamers


So I have started to suspect that we will have a better shot off getting the Ultimate Symmetry designs to work, if we instead make Same turning aptamers.

https://drive.google.com/open?id=0B55atkAMoafyX2REYzljeTg2NGs


One more Experiment


I think this call for another experiment pitting two such sets against each other. :)

#sameturningaptamer versus #rotatedaptamer

Sameturning Ultimate Symmetry versus Ultimate Symmetry
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Biased Guide DNA


I wonder if the guide DNA chosen for the CRISPR labs have to do with anything specific? I wasn’t able to look up the sequence. Tried it backwards too. ;)




I couldn’t help notice that the guide DNA for the CRISPR labs have a strong sequence bias. The target DNA has CU (pyrimidine) bias, whereas the RNA part of it has GA (purine) bias.


I happen to like it. It is very switch like. I won’t be surprised if there is some bias to where CRISPR likes to land.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Why do switch RNA like repeat sequence?


Back when switches were new in lab, they caused me wonder as to why they would carry so much repeat sequence. Turned out the repeat bases in the design came from the locked bases in the FMN sequence. The aptamer itself carried repeat bases and as such sparked repeats.


However I found out this was not an isolated incident just relevant to the FMN aptamer.


The sequence repeat seems central to switch elements like aptamers, MS2’s, microRNA’s and switch inputs in general.



Long and short RNA bases

I think there is a specific reason for this. I think it helps them switch... :) Bear with me.


There are long bases and there are short bases. The short bases are Cytosine and Uracil. The long bases are Guanine and Adenine.

Why do basepairs pair up?


RNA behaviour explained with Lego


I have found a new and better way to illustrate my point that RNA switches are having certain repeat bases and why.

Static RNA likes its base pairs rather well mixed up. Switch RNA is different.


Switch RNA tends to hold rather specific repeat sequences. 


https://drive.google.com/open?id=0B55atkAMoafySEdlRjg4d1ZNNmM


At least when it comes to lego, it is obvious why the mixed bases at the left bind much better together.


Whereas there are little except hydrogen bonds to hold the two RNA stacks at the right, together. I guess the bases can stack better when they are of similar size. So for the switch bases, they can bind through hydrogen bonding, but them not truly mixing,

Haven’t had enough Lego? Read Ksteppe's beautiful introduction to energy in the RNA world.


Understanding Free Energy (using Legos)



Background posts

For the background story on repeat sequence in switch elements see:


Adventure in Riboswitch Wonderland

Here is the backstory of finding the periodic repeats in the early EteRNA Switch labs:


Can periodic repeats in RNA switches be programmed?


Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Gerry Smith sent me a question about a design. He has allowed me to share our conversation for the benefit of all.


Hi Eli -

If you have time, take a look at these two designs. Zama sent me the first. I liked it because it had minimal movement.

So I added another static stem closely on the other side of the aptamer. So the aptamer is closely bordered by two static stems.

Also the folds & movement in all three engines are relatively the same.

I am trying to employ what I understand from your observations to improve designs I come across.

Is the altered design an improvement?

thanks Gerry

Zama design
http://www.eternagame.org/game/browse/8047753/?filter1_arg1=8220506&filter1=Id&filter1_arg2=8220506

Altered design
http://www.eternagame.org/game/browse/8047753/


My answer:

Hi Gerry! 

Yes, you did improve the design by tying some of all the excess bases away. However your design and Zama's are likely not going to have the MS2 turned off. 

In this case minimal movement is likely not going to be good. (But keep looking for it other places) 

This is an exclusion design. What they usually need (Talking of FMN that I know) is the following

1) MS2 next to one of the aptamer sequences. Check - you got that!

MS2 is strong, so just the opening base pair splitting will not be enough to turn it off. The MS2 molecule binds at the hairpin loop. So it needs a helper sequence to get shut off. 

2) A turnoff sequence that is right after MS2 and preferably targets an identical sequence stretch that is present in both MS2 and in the aptamer. This one both of you are missing. 

Best way to show this is to check this past winner: http://www.eternagame.org/game/browse/6369184/?filter1=Id&filter1_arg2=6456051&filter1_arg1=6456051

Swap between the states to get a feel for it. In particular notice the base stretch at 44-48. This is the turnoff sequence. 

Also take a look at this puzzle again: http://www.eternagame.org/web/puzzle/8057283/
Photo of worseize

worseize

  • 29 Posts
  • 12 Reply Likes
Thanks for tool (booster) it gives solutions fast , but in general this only makes same structure foldings. So we can find best solution of some structure , but in other way of making best score solutions is to make many of structures instead (I believe it gives better result than thousands solutions of same folding structure) As i see today (after i started to use booster) there is coming a problem that 150 solutions for player is not enough.

And I have a question about OpenTB ... What our gamers give to medicine ? Is any company started to make a drugs that can heal tuberculosis or it is just for make gamers to believe that they do an important work and it doesn`t give any result ?  
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
I agree with worseize so I don't use it. I get one to work, mod it 4 or 5 times to obtain different structures, then reset and go at it again. I'm maxed out so you might think of increasing the maximum allowed.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@JR I admire your approach to labs -- trying different ideas, with only a few variations, and still managing to fill all your slots.  Good work!

As for increasing players' quota of slots, it's definitely on the table for consideration.  But there was a rationale for setting it where it is.  Even at 150 slots per puzzle per player, it would be possible for about 20 proficient players to fill up all the experimental slots.  A few, like you, have the dedication and patience to generate that many designs without any script assistance.   But there are even more who could simply use their familiarity with scripting to generate however many designs they wanted.

Basically, we wanted to try to level the playing field between the few technically proficient and the rest of the players.  It is a two-pronged approach.  First of all, to give all players some access to automated tools, but at the same time try to diversify the submissions by encouraging as many different minds as possible to tackle the problem from their unique perspective. Hence the per/player quotas were set relatively low.

We've never been very good at predicting in advance how many players and how much effort will go into a specific lab round, and so there is always some guessing at the beginning.  Some times quotas get lowered as time goes on, and sometimes they get raised.  Sometimes deadlines are extended and sometimes unused synthesis slots are transferred to a different experiment.  In all probability, one or more of those will happen in this round as we get closer to the deadline.

So thank you for your input, and most of all, your dedication!
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
I wasn't actually badmouthing the new approach to the labs but trying to motivate player to deliver, nor am I expecting an increase in the design max. If I can do it, so can they.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
I assure you, I didn't think you were bad mouthing anything. I took advantage of the opportunity to share a little context of the kind that often doesn't make its way to players. :-)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@worseize Re your question about OpenTB and the potential contribution to medicine: Unlike OpenCRISPR, which is actually targeted toward medication, OpenTB was targeted toward diagnostics. Specifically, toward a low-cost, rapid result, paper-based test for active TB that could be used without needing a hospital or laboratory, and especially in less developed parts of the world.

Eterna was (and is) at the frontier of this challenge.  The OpenTB challenge demonstrated to the research community that it is feasible to design a single RNA molecule that can sense and "compute" the relative ratio of three blood-born messenger RNA molecules that is highly correlated with the human body's response to active TB.  That is only the first of several innovations that will be needed to make the dream a reality.  But it has made the point strongly enough to prompt the next stage in the development process.  I don't want to preempt the Eternacon excitement by saying more here, but do stay tuned, digitally if you can't make it to Eternacon in person.