Johan’s microRNA Lab

  • 3
  • Article
  • Updated 4 years ago
I decided to create a new forum page, since we don’t have a page specifically for Johan's Sensor Lab. Another more pressing reason is that the obviously related post Switch Scores for EteRNA Switch Puzzles is already so long that it split in two and it is hard linking back to earlier comments. So here is a fresh start. :)

Thx Johan, for the awesome lecture on the dimers and MS2 results! For those who have not seen it yet, check it out here:

Riboswitches On Chip results presentation

The microRNA lab is also related to the XOR puzzle challenge, that also has microRNA’s, here is link to the forum post on that as well.
Our first multi-input puzzle!
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Posted 5 years ago

  • 3
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I have made some early observations on the microRNA data. I used a cutoff line at 10 clusters. I did a bit of drawing based on what patterns there seem to be for the high scorers. Drawings first, text and spreadsheets afterwards.






Sensor for hsa-mir-208a

- Mir likes to pair in full with lane 2

- MS2 mainly prefers pairing with mir and itself. Usually the first stretch of MS2 slides and pair with itself, leaving the last part of the sequence pairing with the early part of the MIR before its stretches of A’s.

-This lab has more variations in how its winners are solved than the Turnoff v2 variant, so for GU’s there seems to be a pattern for those where the CCCAC stretch seems to form a loop/stem, like having 0 GU in state 1 and 1 in state 2.

- The high scorers really don’t use G or C segments. Instead they have a mirror fragment that is complementary to an early stretch of the MS2 sequence.

- Has static stem that seems to form of otherwise inactive bases. (6-7 base pairs)

- Generally seems to be partial moving switches

Spreadsheet mir-208a


Turnoff v2, variant 2

- Mir likes to be part of a multiloop and pair with both late lane 1 and late 2. Thus forming a multiloop with the design.

Actually this behavior of both ends of the mir being split up and the loop section form very much reminds me how the microRNA’s behave in the XOR puzzle. This virtually goes through most of eternabot’s solves. Although here, the middle “loop part” of especially the “yellow” microRNA, gets made into a internal loop and both microRNA “stem stretches” are made to form stems with the design. Similarly for the “green” microRNA, it often ends up having its ends form stem with the design, whereas its middle “loop part“ ends as multiloop ring stretch.

Wuami's doc of Eternabot solves:

https://www.dropbox.com/s/ixpw2lm2clc...

- MS2 likes to pair with early lane 2 + self

- Has a C/U segment. It was more often the red stretch in the MS2 hairpin that were targeted, where the C stretch were often partly left outside in single base area.

- State 2 seems to like having more GU’s than State 1, but generally both states seems to like them.

- Has static stem that seems to form of otherwise inactive bases. (10 base pairs) I bet length will largely depend on how many single bases are left over and not part of the switching. Bases not used for switching is generally left better off, by getting tucked away, by pairing with themselves. Except for a few spacer bases in multiloops, internal loops, and endloops and sometimes dangling ends.

- Generally seems to be partial moving switches

Spreadsheet Turnoff v2, variant 2


Turnoff v2, variant

This one is more mixed.

- Mir likes to be part of a multiloop and pair with both Lane 1 and lane 2. Preferable close to the MS2 sequence.

- Mir likes early lane 2 and middle lane 2

- MS2 has no clear preferences with what data there is yet.

- Most seems to be full moving switches

Spreadsheet Turnoff v2, variant
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I have started to collect some more thoughts about the microRNA labs plus redrawn the oversight images for the microRNA labs.

Thoughts on the microRNA labs


MIR 208A



Here is a screenshot from the lab list. As can be seen, most of the top scorers follows the exact same pattern for a solve. First a static stem in both states and then a mirror complementarity game of 6 base pair stems going complementary from MS2 to MIR.



Broken more down in details




MIR 208A - variant solve

Now there is also a variant solving style, which is highlighted in the above lab list. Here is a drawing for how those designs fold up.



The minority solves follows a magnet segment style - having short but strong segments do the switching, whereas the majority of the designs follow the complementary fragment style. Or zipper as Nando calls it.

For this solving the mir pair up in lane 1 which is opposite most of the top scorers in round 1. I made a variant for the round 2, where I made the MIR sequence cover Lane 1. (The stretch before the MS2 sequence).


http://eterna.cmu.edu/game/browse/575...

I’m not expecting it to work as well, as I can't make the MS2 turn off sequence also be complementary to the last bit of the mir sequence. I think the mir fragment 1 is far less suited to become complementary with the MS2 complement. And therefore I strongly suspect that having mir pair with lane 1 instead of the top scorers that had mir pair with lane 2, will not do very well.


Sensor V2, Turnoff variant 2



Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I have been trying to draw up the switch mechanism in a different way. I'm hoping this will help us visualize what is going on. I did the drawing for the Mir 208 lab since this lab is the one that conforms the most - the majority of the top scorers follows this pattern - and also it is easiest to show tendencies in. I did the drawing over the winner JL zipper 52: http://eterna.cmu.edu/game/browse/548...

First an image of the design


Now the drawing


Notice how each strand is complementary with the next or almost - there are a 1-1 loop forming in each state in the zipper areas, as can be seen in the first image.

In the other mir lab, Sensor 2, turnoff variant 2, there are similar tendencies, however the strands are not directly overlapping to the same degree as in shown above, but often sliding a base or two between complementary shifts.

However this is not necessarily a bad thing, as this show that if it is impossible getting a direct complementary match going from MS2 fragment to MIR fragment, then one can make the strands slide compared to each other and still achieve the same thing - a working switch.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I also made a drawing for the Sensor v2, variant 2 lab. It is based on the topscorers from the lab.

Notice that it uses the exact turnoff mechanism for MS2 as in the above drawing of the mir 208A lab (when looking away from the states are reversed)

When the MS2 hairpin is turned off, segment 1 and 2 pairs up.

Example with lab design based on Mat's highscorer mod of JL: http://eterna.cmu.edu/game/browse/548...



Drawing of switching mechanism
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
I've created a Fusion Table for the designs that are close (within 20 base mods) to Eli's winning design Zipper 46 - 13. Once we get a Fusion table for the lab results (hint, hint) perhaps we can merge it with this table to see what effect minor changes seem to have.

And a special shout out to Eli, Mat and salish99 for having so many winners in this round!
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Thx for the Fusion Table!

Also sending big thanks back to you for making so many fine 1 round designs that we could build on to. :)
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
I added a chart of ID versus distance which seems to show that there may be several clusters of more closely related designs. It could be interesting to look at some of these clusters to see what base changes seemed to matter more.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Ah, now I get it. The big numbers are lab id numbers. Cool way of pulling out clusters.

I have been looking at a few the winning designs that had many close design mods. Zipper 23 and Zipper 46 in particular.

From what I see till now, the microRNA prefers having very close complementarity to the main design. Most bases added that weakens complementarity between the microRNA and the main design score less well compared to the highest scoring designs. Especially not if there are more weakning bases added. All the winners (except 1) insist on having 5 U's as complement to the 5 microRNA A's.

However I have found a few cases where a GU did benefit, and interestingly enough it was formed at either end of the complemtary section to the microRNA.

I have added a new "chapter" :) in my collection of notes on the microRNA labs.

Small mods - what is preferred?
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
Didn't even notice the results were out yet, thanks, j.
Photo of salish99

salish99

  • 295 Posts
  • 58 Reply Likes
By the way, one of the carrots I am chasing after is inclusion in a publication on this topic, so thanks for the shout out to us.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
John posted a link in chat today to the R95 spreadsheet; I made a fusion table from it.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Comparison with last round

The trends that I mentioned from last round 208a MicroRNA lab held.

There are two main solve variants. A minority and a majority type. The majority type uses complementarity for switching and the minority one relies more on magnet segment.

More about it here:

Overall trends
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
MicroRNA and entropy

I was curious to find out what was normal entropy for microRNA’s. I found a database over microRNA and checked under human microRNA

mirbase

I ran through around 30 different microRNA’s through Vienna, to get a feel for what entropy I could expect. Most of those I seen wouldn’t be very happy about forming a strong stem with themselves. Most are in a 0.8+ entropy range. I only found 1 with lower entropy (0.2) and most are above +1. And there is a tendency for raised entropy in what ever stem region may form.

They are either a long mix of A,G,U with little or no C’s

And even if they have a more balanced rate of G’s and C’s, entropy is still way high.

Probably makes good sense that microRNA are not too happy about forming with themselves. Means they are ready for action when a fitting messengerRNA or one of our designs come by. :)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Hi all!

I lately found a couple of really interesting videos about microRNA.

Animation style
Medical Animation – MicroRNAs from Katharina Sophia Petsche on Vimeo.

Friendly scientist presentation style
MicroRNA - Amy E. Pasquinelli, University of California, San Diego from Kavli Frontiers of Science on Vimeo.

For those who want more and who haven't already found the videos I previously shared, here is a playlist with my favorite microRNA videos so far. I'm particular fond of the first two by microRNA pioneer Anna M. Krichevsky.

Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Imagining the microRNA labs

I have been drawing some new drawings of the microRNA labs. Not as much because the tendencies in my drawings of the 1 round changed much - but more as a way to cast light on different areas that I think can be of potential interest.


A landing spot for the microRNA

I mentioned earlier that all the topscorers in the microRNA labs seemed to have a dangle of single bases hanging around, complementary to the microRNA. Salish got me inspired, so it ended up over in the MS2 switch post, while it was really about microRNA.

MicroRNA tail dangle

I simply think the microRNA uses this complementary dangling spot in the design as a easy landing spot.


Main solve types versus minority solve type

All the majority type of solves, have a loose dangle of a tail that matches to the one end of the microRNA. Normally designs pack away most of their single bases. At least at the ends of the RNA sequence. And single stretches of bases - with a majority of non A’s are usually hid between elements, rather than at ends. If at ends they have a habit of causing misfolds. Especially when there is as much non A content as is the case for these particular microRNA complementary dangles. In the single stranded barcode labs I made with a dangling barcode, they had their barcode tails pair up unwanted with all sorts of things - like nearby sequence or sequence nearby in 3D space - like 5' hook or neck bases. That’s why I found the dangle present in the microRNA’s rather peculiar.

Single Strand Barcode

But the minority solves, don’t have their dangling microRNA complement fully at the end of the section. They have an element in between.

When I mentioned this difference between majority and minority solves to Machinelves, she came to the same conclusion as I: That having the complement stretch inside of the sequence makes it harder for the microRNA to get access, because the design itself would get in the way of the microRNA hooking up.

As she said: I have no idea but a loose guess of why dangling inside is less optimal, is energy interference and blocking from the molecule itself. Things on the ends, are more free.

The energy part reminded me of something Cody said:
Entropy lesson: A tail sequence has higher entropy compared to a loop sequence. This is because a tail can gyrate in more directions than a loop can (which is locked down on each end).

I simply think the microRNA is more free to feel out a potential landing spot for binding in the end of a dangling sequence compared to bind to single inside a loop or a multiloop ring.

High entropy is normally bad when it comes to static designs. But in these microRNA switches I think it actively helps the connection form between microRNA and receiver design. And I think when the microRNA has first attached, it can push open the rest of the design just by the strength of base pairing.

This brings me to something, that I think matters for the amount of high scoring designs. Length of that complementary dangle.


Length of the dangle

I made a lab summary with Omei’s fusion table:

Eterna R95 results

Based on the designs scoring over 94, having 20 clusters and max 1.4 error rate. Counting dangling bases that are complementary to the mir. Round 1 has few high scorers and low cluster count, so I excluded it.



Now the turn-on labs (Like mir 208A) usually have a score advantage over the turnoff labs (Something which has been clear from the MS2 labs also) Anyway, I did a comparison of the round 2 microRNA labs. Just keep in mind that 208 is in a different category from the others.

Which labs came out with a higher count of high scorers than the others?

The labs that kept the longest mir complementary dangle. :)

Mir 208A has a dangle that is typically around 7-12 bases long. (Late in sequence)
The minority solves have 8 + 4-5 dangle bases. 8 gap bases late in sequence and 4-5 internal loop bases early in sequence.

Sensor v3, turn-off variant 1, has a dangle around 2-4 bases long. (Early in sequence)
The minority solves have 5-7 (in a multiloop)

Sensor v3, turn-off variant 2, has a dangle 8 bases long (Late in sequence).

Another thought hit me. perhaps this is why the microRNA labs can tolerate so long MS2 gates, since the dangle is helping untangle the design?


How to make a lab summary in Fusion Tables

It was jandersonlee who taught me how to make a lab summary in Fusion Tables like above, so I can display the labs against each other and compare how many high scorers each lab has.

Here is an intro on how to do it.


Which part of the mir is targeted?

So far it seems that the mir complementary dangle targets a specific region in the mir. In the winning designs so far, the early part of the mir (Mir 1 as I call it in my drawings - and colored pink - shown below).

This can be seen in all the drawings, even of the minority ones. The mir 1 (pink) is aligning in sequence with the purple dangle.

Only exception is Sensor V3, Turn-off variant 1 - Majority, where the mir complementary dangle is at the beginning of the RNA sequence. There the mir targeted is the Mir 2. I wonder if this will be the tendency for all the solves where the dangle is placed early in the RNA.



Perspective

I think there will be relatively few ways of legally solving each microRNA labs. With the majority of the winners follow the same main pattern for overall structure.

So I think if we get length of the complementary mir dangle right, plus places it at ends of the RNA sequences, we should be making a ton of fine microRNA designs in no time. :)

There may even be a preference to which end of the RNA design the dangle prefers to turn up in and for now it looks like the end of the RNA sequence. But we need more data to know for sure.

I’m also guessing that base in the static area, allows for more sequence interchanging, than a base in the switching area. In particular in the area binding up with the microRNA. At least that’s what I think I learned from my lab mods. Most of the base changes I did in the microRNA complementary region, didn’t improve the original design score, rather the contrary.


Drawings of tendencies for high scorers

Main type solve











Minority solve type



Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
Eli wrote:
>I simply think the microRNA uses this complementary dangling spot in the design as a easy landing spot.

That certainly was the intention in my designs. I typically used the dangling tail as a match for the dangling tail on the miRNA. The idea was to help line up the two RNA strands for bonding.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Super cool! Your strategy worked. The microRNA designs from round 2 have confirmed, they love your round 1 strategy. :)

And us copying it, lead to more winners in round 2.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Now I think I also understand why me changing bases in the mir complementary stem area, so they became GU's when the mir and the design paired, were mostly counterproductive, as it gave the mir less momentum to unfold the rest of the design.

Only sometimes a GU made in combo with design and microRNA pairing, at the end of the stem actually improved score.

Small mods - What is preferred?
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Winner reversed engineered

While I was working on my microRNA lab designs, I realized something. So I'm hereby passing the tip on.

The microRNA labs seems to strongly favor pairing up with a complementary dangle of bases at the end of the design sequence (the 3' end). Plus they prefer doing so with their beginning bases (5' end).

And I think this is what microRNA prefers, but in the third lab, this was not the case. So despite we managed to make winners in the Sensor V3, turn-off variant 1 lab, I think that another approach may work better. Or at least be worth a try.

In this previous round of Sensor V3, turn-off variant 1, its dangle land in the beginning of the design sequence instead of the end. But it doesn't land at the start. And I think that the dangles strongly prefer being at sequence ends and not in between elements as the rest of the design then has the option of getting in the way of a proper pairing up with the microRNA.



Inspiration for lab designing

I realized that that it would be possible to move the static stem, from the end of the sequence, so it didn't take up the favorite spot of the microRNA. So I moved it in between the MS2 and the complementary dangle.

Here is my first design following this approach. I have not yet fully achieved to make a longer late sequence dangle at the sequence end, that also shows some strong bases. But that's what I'm working towards. Feel free to mutate and modify as you wish.

Title: Winner reversed engineered
Link: http://eterna.cmu.edu/game/browse/596...


Background articles

You can read more about the patterns microRNA designs seems to follow, in these earlier posts:

MicroRNA welcoming dangling tail

GoogleImagining the microRNA labs
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
Thanks for the tip, Eli. I'll see if I can try a few in this style.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Np. And sweet. If anyone can make it work it will be you, since you came up with the dangling tail strategy in the first place.

I have found that it is hard to make a MS2 gate with this new way of solving. Such a one is often needed in turnoff labs, and the microRNA labs seems to be particular fond of them. Turnoff labs or not.

I can make it but it will often be involved in one less pairing up between microRNA parts and MS2 gates, compared to the winners from last round. Which could be a problem, since the zipper style where two set of strands pair with two other set of strands, and then swap partners in the other state, is pretty strong.

The bases before and after the MS2 should pair with each other, but should also each pair with at each end of the the microRNA.

Perhaps what the design is telling, is that it really really want the last bases deleted, (those that were turned in to static stem in last round winners.) so the microRNA can get a clean and ready available complementary dangle at the end of the design sequence. Since the static stem when outside of the action area, do not seem to play a crucial role, when it is not in anyway involved in the switching area.

Anyway, I look forward to see if we can make it work.
Photo of whbob

whbob

  • 193 Posts
  • 58 Reply Likes
Thank you Eli.
I had not entered into any labs until I read this post.
I tacked the microRNA to the ends of the RNA strand, reduced the size of the multiloop with a stem and found a way to break the MS2. Added some GC pairs to improve the melt plot slope and submitted my first lab solution.

Your comments in "Fun RNA and DNA science" also inspired me to take the plunge into labs. Thanks!
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Np, whbob. Good job getting started on the labs! :)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Position of the MS2 turnoff sequence in microRNA


Last round I attempted move the MS2 turnoff sequence from JL’s winner in the Turnoff lab, Variant 2 to the Turnoff lab, variant 1. I used exactly the same MS2 turnoff sequence as found in JL’s variant 2 winner, from round 2, but with not uplifting results.

Sensor 3, v1 - 5 


Original winner in Variant 2, round 1 by JL (94%)

JL Turnoff v2 99


What variant 1 want - for now round 2

Sensor V3, v1 - 91 (94%)


This exact trend hit through in the rest of the variant 1 lab too. The lab disliked a late positioning of the MS2 turnoff and liked a early positioning. A strong C segment was preferred for MS2 turnoff before the MS2 segment, not after as in the variant 2 lab.

I think it is simply dependent on the position of the MS2 itself in the RNA sequence. If early, then the MS2 turn off is right before MS2.


And if the MS2 sequence is late in the RNA sequence, then the MS2 turnoff sequence lands right after MS2.


This trend show up to a far lesser degree in the non microRNA labs. Probably because there is not a long microRNA sequence that needs to pair up almost in full - which is a very radical change between two states in a switch. In the exclusion labs there seem to be a general preference for the MS2 turnoff sequence to be after the MS2 sequence, unless the MS2 is placed very very early in the RNA sequence. (Exclusion 4).


Turning of the MS2: Memory rule


The MS2 turnoff sequence is for turnoff labs.

The same state labs do not have MS2 turnoff sequence right next to the MS2.

Rather they are like wound up springs. Waiting to get released and turned on. The MS2 is usually bound up in each of its end a good space a way. And usually have to make a switch jump to get turned

Released and relaxed spring

Image Credit

Wound up spring in state 1 (left), released spring - MS2 bound up - state 2 (right)

salish99_ss1_r3_093 (94%)


Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Turn on lab (Sensor 208a) MicroRNA landing spot


The microRNA strongly prefers fully pairing up with the RNA design 6 base to around 27 after the MS2 sequence. This lab had a strong preference for a 5 base pair MS2 gate - containing a GU at the MS2 gate end furthest away from the MS2.


I’m counting on this MS2 gate trend to continue. I expect the same switch mechanism to be in use in future labs, although I know the sequence will need to change slightly, when we get a similar lab but with a different microRNA. As the MS2 gate sequence needs to be complementary to both the MS2 and the microRNA, as already mentioned here:


Switch mechanism


There are a lot of designs that attempt to make the microRNA pair up with the design before the MS2 also, but they are generally low scoring.


There is only the minority solve type based on one of Brourd’s round 1 designs, that achieves to make a middle solution where the late part of the microRNA pairs up before the MS2 and the early microRNA pairing up with the design after the MS2 hairpin. It actually looks more like the majority type in the turnoff lab solves, that likes a similar and not totally binding up positioning of the microRNA.


So overall I think that the turn on RNA lab is less than pleased about any pairing up early in the microRNA design.


For now I’m guessing it has to do with the MS2 turnoff sequence preference. There seem to be a general preference for MS2 to get turned off with around 4-6 bases after the MS2 sequence. Unless the design is forced to do otherwise, because of a nearby FMN sequence or by early placement of the MS2 in the RNA sequence.



MicroRNA Turnoff labs - MicroRNA landing spot


The turnoff lab prefers having each end of microRNA pair up on either side of the MS2 sequence. The variant 2 lab does well, the variant 1 lab has trouble, as it has a harder time getting lucky having the microRNA complementary dangle on the 3’ side of the design.


The turnoff labs generally seems to have a harder time solving. Not just for microRNA, but for MS2 switches overall.


In the microRNA turnoff lab Version 3, variant 2, it shows by the lab having a far longer complementary dangle to catch the microRNA, than the turnon lab, Sensor 208a. 12 bases in the turnoff against 8 bases in the turn on.

Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

MicroRNA seed region


I was rewatching some of the microRNA videos I shared earlier, when it dawned on me that there were something I recognized.


MicroRNA videos


What the microRNA designs seems to love more than anything, in the round 1 winning designs in 2 of 3 labs, are, dangling a microRNA complementary stretch their 3’ tail to specifically catch the 5’ tail of the microRNA. (The labs Sensor 208a and Variant 2)

Something I described in more detail in the post MicroRNA welcoming tail dangle.


MicroRNA on the prowl


Our microRNA catching designs likes to lay out a single base snare of microRNA complementary bases. 8 bases and sometimes even more.


This is exactly what I have been hearing about how microRNA like to land on a messenger RNA (mRNA).


Start at minute 24-26

The microRNA generally like to use its 2-7 first bases (its 5’ end) to hook up with the messenger RNA. This section in the microRNA is what the scientists calls the seed region.


Here I found a fine definition of what the microRNA seed region is:

https://www.qiagen.com/dk/resources/faq?id=d5eb2638-a655-4f47-a8e1-0b8c76653e41&lang=en


The microRNA in our labs, is attaching in a way that resembled how microRNA attach to messenger RNA.
 

Third stubborn lab - Variant 1


The third lab was low on winners in round 1 and 2 and is actively open now for round 3.


On the basis of what I had seen jandersonlee have success with in round 1 - namely dangles - I decided to repeat that strategy.


The tail of dangle will far rather be last in the RNA sequence (3'), not in gap bases between elements or in multiloop ring.


But since there were not real good space to put it the way that was successful in the two other labs, I decided to go naughty. So as there were not good space at the 3' end, I put the dangle at the 5' end instead.


I managed to make a winner in - that also had decent cluster counts (20+) - by making a complementary dangle that targeted the “wrong” end of the microRNA (3’)  :)

Sensor 3, v1 - 91 (94%)


Though it was possible solving this way, I strongly suspect that that microRNA really prefers saying hello with their 5’ hand and that 3’ hand is far less effective.



Perspective


So it seems that this tiny microRNA worm behaves as it and its family members always have. :) Ok, since this mechanism originally evolved. Using its 5’ end to sniff out its target messenger mRNA/s so it can silence or mark for destruction. This way it can very fast regulate how many proteins of a certain kind gets made, in a very fine tuned way, so there isn’t made too many.


So even though this microRNA has gotten thrown into a new connection and given as a task to us, to design microRNA sponges, it looks like it goes about business as usual. :)

(Edited)
Photo of Astromon

Astromon

  • 192 Posts
  • 26 Reply Likes
Hi I am unable to work the old labs in the archive section . It boots me then asks for a user name and password. Then it says there is no existing username password match. This is a glitch I would like to see fixed so I can catch up in the labs and perform better. Thanks!
Photo of Eli Fisker

Eli Fisker

  • 2236 Posts
  • 495 Reply Likes
Hi Astromon!

I can understand that you get confused. Those labs look open when one enter, but they should be closed. It is not signaled well. Although it do look like in some of them, players have added designs afterwards, but the designs have not been run.

So best use your energy on the current open labs. Wishing you luck!
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
RNA in – RNA out - Reporter labs

Funny observation for the second round of microRNA and reporter labs, it is rather hard to make pyrimidine dangles at end of the RNA sequence, without having the sequence misfold and hidden away with no unpaired stretches for microRNA hook up.

It looks like this  lab strongly demands G dangles instead. I think those should work fine as well. Main thing is that complementary microRNA traps are laid out and waiting and preferably strong or long ones.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I have made some new drawings of how I go about the current microRNA lab as an explanation to whbob's comment. I decided to move the explanation to here, as for more to see it.

Hi whbob!

I have made a drawing with colors and symbols for attraction of the R2 labs for one of the things that I think could work well. I colored C stretches green and gave them a + sign for showing attraction and similar I colored G stretches red and gave them a - to show their main attraction.

I did this both for the microRNA inputs and for the design. I think this could be useful for showing what a specific microRNA would be inclined to prefer.

Eg if one microRNA has a C stretch and the other microRNA has a G stretch - then placing them on either side of the MS2 is going to be hard, as then they would naturally want to pair with each other and not let the MS2 go. So you can use their nature to say something about what they will prefer and need.

In this lab where TB A needs to kick out TB B, I take advantage of that MS2 and TB A needs to be gone in the same state (1) and use the TB A complement to help turn off the MS2, in those designs I have called A and B sharing lanes.



Example:


Here is an illustration of another route to get to a solve. I have called this design route B before A. Here I take advantage of that MS2 and TB B are directly complementary and use it for MS2 turnoff in state 1, where both needs to be gone.



Example:


Notice that I in both illustrations have put the static stem first. Our earlier microRNA lab data has shown that the microRNA mainly prefer to land in the late end of the RNA sequence (3') in turnon labs, which R2 is.

Turnon and turnoff is taking the perspective of the MS2. Here MS2 is needed to get turn on in the later state = hence turnon lab.
Photo of whbob

whbob

  • 193 Posts
  • 58 Reply Likes
Thanks Eli, 
This is excellent!  I hope all of the newer players get a chance to read this.  
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Just wanted to leave a note here on a bit of analysis I did that relates to the single input microRNA labs. I think I now understand why our past microRNA labs have such a strong want for longer MS2 gates. Search for the section:

MS2 gates in the microRNA labs

Short sum up: My latest advice for single microRNA input labs is to make MS2 gates. The pattern jandersonlee made for first microRNA round, I think I know why it is needed. The long MS2 gate is simply a way to secure that the MS2 is force held from both sides, which means a better chance for turning it of and on. The word change gaming complementarity of letters between the switching stretches, is just a way to get it glide also.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Static stems and the microRNA labs


I think I have been too quick ruling out static stem as having a role in the microRNA labs.


I decided to fuse the Same State 2/NG 2 blueprint with that for the microRNA's and I ended up with this. Second state even has a multiloop. Which I like. :)


Mixing blueprintspng


I haven't gotten the 4 red G's in a row dealt away with yet. So anyone capable of that, please give it a go:


Here is my sequence for now:

GACUUCAGAAUAACUGGAGUCAAACUUAUUCUUUAUACAUGAGGAUCACCCAUGUGUCGGAAACCGAACUGGGGAGAUGGGUACG


MicroRNA versus MS2FMN blueprintjpg


Background posts

MicroRNA blueprints

Same State blueprints

Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

I decided that the static stem would probably turn up at a similar pattern to that I have seen in the MS2/FMN switches. (1/4 and 3/4).

1 fourth 3 forthsjpg


I managed to get to a solve by placing the static stem on the opposite side of the MS2. Now time will tell if lab agrees too.


Static stem in switching areapng


Drawings of each option

Coming blueprintsjpg


I'm convinced now, that static stems will play a role for microRNA designs too and will be particular needed the more microRNA inputs we get. The static stems can function as domain spacers. Making sure that the growing amount of magnet segments and switching elements are not complementary too many places. Guiding the stretches that are intended to pair towards a pairing.


One of the problems that have seemed more outspoken when I try to solve a double input and triple microRNA input puzzle, is that there are more unwanted pairings than with just a single input microRNA puzzle.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
The idea that a static stem can be used to to suppress an undesired interaction is a new idea for me.  Good work in identifying that!
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

R2 - 2 states model - Analysis


I put up a series experiment to test the presence of a static stem in a microRNA design with two inputs as mentioned above. So how did it go?



Leaving sequence before staying sequence


I have been claiming that A needs to go before B, when A needs to be kicked out and B needs to stay in an exclusion type lab.


In the R2 lab, both sequences share a strong kennel attraction sequence - CCCA. A strong shared sequence is often a good starter for an overlap and lane sharing. Or for making a common sequence in between them.



However in the R2 lab it is far the easiest to put B before A, for making sequence share, but that order is the opposite of what I wanted.


And while I think this is the easiest way to achieve a good score in an exclusion lab, with an overlap between the sequence and have them share lane in this particular order, it is not to say it can’t be done otherwise. It is all really a game of balance. You just have to tip the scale right.



Addition Scale

http://etc.usf.edu/clipart/50100/50142/50142_add_scale.htm



Static stem in the switching area


I have been talking about the potential use of having a static stem in between switching elements, both for shielding elements from each other, but also bringing other elements close that needed be close.


For the experiment I mentioned in the post above, I made an almost winning design.


Score 92%

Static stem in the switching area


I placed half of the TB A sequence at one side of a static stem and half of the MS2 at the other side. By this maneuver, they could both turn each other off, but these both half would also both be bound on in another setting in state 2.


By this I was mimicking the reporter labs of the type miRNA-in, reporter-in, that had both their sequences turn each other off in state 1, but both were bound by each their sequence in state 2. A zero to 2 sequence binding step.


Outline from drawing made for reporter labs:


0 binding to 2 sequence bindingpng


Here the sequence inputs have either a static stem in between them or a short loop.



Stem or loop between sequence inputs for turnoff?


I think there may even be a pattern to what to pick when. A loop or a static stem between sequences that needs to be turning each other off in one state but both be on in the next state.


If you want two sequences disappearing and then both binding, having a stem in between seems to be better than having just a loop in between. At least the mir-in, reporter-in lab with the short reporter sequence, more exclusively prefers having a stem between the inputs.


If you want two longer sequences to go from not being there, to both be binding up, a loop in between the sequences may be more effective than a static stem.


At least the cooperative results seems to suggest that a static stem seems less effective than having just a loop in between the two MS2’s. And these MS2 sequences are longer.


Plus the top scorers in the mir-in, reporter-in lab with the long reporter, where the sequences are of more equal length (similar length to MS2) seems to be more in doubt on whether to go for static stem or loop in between the sequences.



Perspective on order of sequences shared


I can’t make the weaker TB A sequence that should be the staying sequence, to go last in order - whilst sharing lanes. Only opposite. While I can balance the design by adding a static stem and it will probably end up having a winning sibling after this round, judging from the many lower scoring designs there were in my series, I also believe it may be hard to achieve a lot of winners this way.


So I think the way to get real high fold change and a better shot at getting winners, will be go with the strategy with the leaving sequence before the staying sequence, with a MS2 in between and have these spaced well out. Which is exactly what JR did in his R2 winners. I think it is the superior strategy provided that a sequence share after preferred order, is not possible.

Or put another way:

If sequence abbreviating can’t be used - like sequences sharing lanes, MS2 overlapping with one sequence (R2) or both (R3) then the RNA designs with two inputs tends to use most or the full RNA design.


The overlapping strategy where switch elements share lanes seems to be mainly of use if only one variant of the puzzle needs to be solved. I think for logic gate labs where many puzzles needs to be solved with the same sequences, it is going to be real hard having perfect matches for sequence overlap which ever way, the oligos are going to be placed in relation to each other.


Extra added note: Actually I did make the B go before A and 86% was the highest achieved score. I may have placed the design complex at the less optimal end, the design complex seems if not taking the whole space of the RNA, seems to have favorite ends.

So I have moved this design to the opposite end of the RNA in this round to see if I can get a better score. One thing that may speak against it is that the MS2 will get dangerously near to the end of the design, something it has regularly shown to dislike. On the other hand, two input labs seem to be a bit more tolerant to this.

(Edited)