Lab scoring

  • 1
  • Article
  • Updated 6 years ago
Just having a quick look...
nascarnut in Lab 3376171 and JR in Lab 3376325 both submitted the same sequence.
GGAAAACCAUAGCGCGUCAGGAAACUGAUGCGUGCCCUUGGCACGACUAGGAAACUAGUCGCUGUGGAGGACUGCUUCGGCAGUCCAAAAGAAACAACAACAACAAC
nascarnut's score returned as 100%, with shape 0.221.
JR's score returned as 97%, with shape 0.5
Photo of Berex NZ

Berex NZ

  • 116 Posts
  • 20 Reply Likes

Posted 6 years ago

  • 1
Photo of JR

JR

  • 241 Posts
  • 21 Reply Likes
That question brought about this Lab by Omei ( 3413597 ), "Reproducibility Lab"
to monitor stability of lab results.
Photo of Brourd

Brourd

  • 454 Posts
  • 84 Reply Likes
To be a bit more specific, JR's design was penalized for 2 to 3 bases, residues 2 and 40 definitely being two of those nucleotides penalized.