OpenTB results

  • 2
  • Article
  • Updated 1 year ago
This is a thread for discussing the analysis of the OpenTB labs and the results

First puzzles:
Let's get started!: http://www.eternagame.org/web/lab/689...
This is it! :http://www.eternagame.org/web/lab/689...

Initial, preliminary data are available for some puzzles in the first round.

Google Spreadsheet: https://docs.google.com/spreadsheets/...
Excel file: https://drive.google.com/file/d/0B_N0...
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes

Posted 3 years ago

  • 2
Photo of Snowpup

Snowpup

  • 5 Posts
  • 0 Reply Likes
Will there be more because I can't find mine.
Photo of cynwulf28

cynwulf28

  • 80 Posts
  • 22 Reply Likes
you are there, try ordering the player column in alphabetical order (to confirm presence), or searching for your name using the "Find" tool located at the far-right of the "Home" panel. I located 9 results myself. In numerical order (see far left column) they are under: 5609, 5613, 5615-5617, 5739, 5740, 6177, and 8204.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
General thoughts on the hard labs

For now it were some fusion style designs that did best for the hard labs. Kudos to Atanas for showing that our sub lab designs really could be added up for the hard labs. :)


Other patterns have started to come through also. Intersection - where an input is split up and bound apart in sequence has started to grow more frequent with a higher amount of inputs. This intersection thing I first recall seeing in some Eized mods I described here.


Another thing. Many of the High scorers have part of their sequence hidden away when in a state where they don’t need it. This is something that can be useful to do in combination with intersecting inputs.  


And then there is seriously inter-entangled designs.


HARD DEC LAB


Funny recurring MS2 like hairpin

Several of my High scorers (a fusion of a Malcolm and jandersonlee design) have something like a MS2 hairpin in the fold connected with the reporter. Something I have noticed in several designs both while designing and looking at others. This is something I have found amusing. The first round reporter sequence in particular even shows great likeness to the MS2 sequence. Although bending opposite.


Score 73%

MS2 ghostpng

http://www.eternagame.org/game/browse/6892314/?filter1=Id&filter1_arg2=7034986&filter1_arg1=7034986


Legit MS2 hairpin

Legit MS2 hairpinpng


The MS2 ghost hairpin is made of the reporter and part of the nearby C complement. Hereby inputs are used used directly for a turnoff against each other by a nearest neighbor strand pairing.



The reporter is being countered by a nearby “anti-reporter” sequence. A MS2 turnoff as I would have earlier called it when we used MS2 for reporters. In this case it was one of the input sequences that fitted to do the trick. But an unrelated but matching sequence would do the trick too.


HARD INC LAB

B complement moonlighting as both switch turnoff and turn on

Half the B complement is used for turning A and R off. The other half of the B complement is overlapping with C and aiding C get turn off when C concentration is good - in other words when A and B concentration is not high enough to counter the concentration of C.


INC 53png


The highest scoring design uses a sequence overlap between C and B for tipping between state 1-3 and 4. B and A are turned off by an overhanging C end tail that targets a G stretch in the B complement. So when C is strong and when A and B are weak, the BrA stretch is binding with itself and turning itself off.


Simplified structure drawing showing inputs against the different states.

Basically one half of the B input is working as either state 3 turnoff or state 4 turnon.



Intersecting style in action

As can be seen in state 3, the C complement that is being involved in the switch is actually split up. In between and hidden is R and its anti sequence (plus some of the A complement too).


Dl2007 mod 2 mutants - intersectingpng

http://www.eternagame.org/game/browse/6892317/?filter1=Id&filter1_arg2=7074110&filter1_arg1=7074110



I have earlier mentioned that I expected intersecting elements to grow more prevalent the more inputs we got. This seems to hold.



Global fold change versus score


There are no design with high fold change. Actually global fold change is generally higher than fold change - which is a new. :)

For these two hard labs all designs gets fold change below 2. So most of the designs don’t switch really well. But we have a fine starting point for improvement.


While several of the fusion design get in the 10 of global fold score, what do get real high global change is a more inter-entangled design style and short distanced interaction of inputs.


For now it seems that in most cases when we raise global fold change, local fold change suffers. And when we raise local fold change, global fold change suffers.



Things that seems to help switching get going

  • Shorter binding stretch for the input.


Some of the smaller labs with just one reporter and one input or two inputs, seemed to get grumpy if the whole length of each each switch element was used.


We are using a lot of the input sequence for many of our hard tb lab designs and we may gain some momentum if we shorten things down.


Things that seems to help raise global fold change


  • Direct interaction between inputs/reporter

    • Simple interaction: Lane sharing with direct overlap between the sequences of inputs/reporters (2-3 inputs)

    • Short distanced interaction: Jumping jack style pairing where inputs/reporter bind directly with each other for turnoff (2-3 inputs) Inputs can be spaced by a static stem.

    • Intersecting of complements. Splitting up input complements/reporter and spaced by another switching sequence.  

    • Inter-entangled style. For a design with 3-4+ inputs - long distance 3D interaction between inputs/reporter or outside sequences starts to become beneficial.


Several of these can be inter combined.



Key point on global fold

Here is what I have seen help global fold change up til now.


The more directly you get the input complements to interact with each other - the higher global fold change you will get.


There are different ways to do this and what to choose will also depend on the amount of inputs and nature of the inputs (eg if they fit well for a direct overlap (lane sharing).



1)Lane sharing with direct sequence overlap

Simple interaction - direct overlap will do - can be done when inputs are short and fits well for a direct overlap with each other. This approach will work well when there are few inputs and when these inputs fits well for overlap. (like 2-3)


This has yielded the yet highest global fold change in the R3 lab. (37%)



2) Middle man sequences


Using neighbor sequences to interact as middle man between the inputs/reporter. (Usually gets higher fold change but mostly is less lucky with global fold change.)


3) Sequence match in 3D - Direct pairing between inputs/reporter

This approach rely on making input complements/reporter pair up in 3D.


A separated but directly interacting inputs/reporter over a short distance. A distance could be created by a static stem or a sequence temporarily packed up in a stem. This former approach was successful in R2 for global fold (10%) and score (95%).


Here is the design with the absolute highest global fold change of the hard TB labs. I have marked the beginning and end of input A and B with black rings.


Global fold change 27%, score 32%

Atanaspng

http://www.eternagame.org/game/browse/6892314/?filter1=Id&filter1_arg2=7017487&filter1_arg1=7017487


What I find interesting about this design, is that the A and B complement are directly connected with each other. But also even with the C complements. They have an option for direct feedback between the different parts.


The B and A complement are capable of turning each other off when neither of them are present and when C is. Thus Atanas got A and B multiplied. If A and B are present they will stop binding with each other.  Now this design doesn’t score well. But I think it shows that when inputs are made dependent on each other they may start show the behavior that we are interested in.



4) Inter-Entanglement

Another approach that also gets high global fold change is making switch elements interact with switch elements or neighbor elements for turnoff in 3D. This was already seen in the logic gates designs. But has been taken to a more extreme degree. A longer range approach can be seen in Brourd’s designs.


Global fold change 24%, score 30%

Greatly entangledpng

http://www.eternagame.org/game/browse/6892314/?filter1=Id&filter1_arg2=7024500&filter1_arg1=7024500



Basically inter-entanglement is a sequence match in 3D.



Perspective for the future

So it seems that what is immediate of benefit to a single concentration - fusion style designs, wins out in the short run and for now. But I think the more inputs we get, a more inter-entangled style will win on a global fold scale. If we can just get it to unstick when needed.   


I think we need think about we can play these different approaches for getting good fold change and global fold change together so we get the best from each.


For now I speculate if we can make these 3D inter-entanglement more MS2/reporter/switch element like, we should have more success making a switch. As I think certain sequences are having an important role in switching.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Correction. I wrote: "For now it were some fusion style designs that did best for the hard labs." I meant this for the hard DEC lab. For the hard INC lab another strategy hit through, where A, r and B turned each other off.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
@ Eli: I really liked your designID 7034986, puzzleID 6892314(AB/C^2-DEC.  I'm imagining that our sequence seeks out inputs from sequence 1 to 85 ( from 5' to 3').

Imagine if C is the first attractor, but B comes along half way down the C oligo and continues after C.

This is like having pages placed on a desktop, each new page overlapping the previous page will dominate. The kernel attractor sequence can't be too strong of too weak to properly switch.  It has to be "just right".

My problem is how to I determine what is "just right" :)

In the same puzzle, Mat747's designID 7094435 scored just below yours.  Looking at it, it didn't pass the folding engine constraints.  

It's things like this that make me wonder if I will ever understand what's happening, but I always look forward to your explanations to help me along :)       
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Strategies that hits through in the hard DEC lab

Winning strategy for now: Fusion style


I mentioned in the above post that I really liked that Atanas made the B and A interact directly with each other in the design that had the highest Global Fold this round. (32%)


However I failed to point out is that the DEC Fusion style 1.41 high scorer (73%) has a similar feature. While the A and B are not distanced by a static stem as in the case in Atanas design, they do interact in state 3.


State 3 and 4, B and A element borders marked by black rings


http://www.eternagame.org/game/browse/6892314/?filter1=Id&filter1_arg2=7034986&filter1_arg1=7034986


Similarly there are actually 2 potential binding sites for the reporter. (In state 3 in between the two B complements. Something which is more clear in one of Mats mods that did well. (68.8%)


http://www.eternagame.org/game/browse/6892314/?filter1=Id&filter1_arg2=7025248&filter1_arg1=7025248

Here is my earlier drawing of Fusion style 1.41, now with extra reporter binding site and A*B drawn in:



Here is the design with the extra reporter site highlighted in the design.


Double reporterpng


I decided to make a fusion with the elements in the same order as this rounds high scorer. So here comes a demo of fusion style aka addition Atanas style.


Here comes the parts that works for fusion (There are more possible combos)


First sub lab puzzle part


cB, cBr (cBA)


One of my sub lab submissions that had same order of elements and had the B complement split.


cBr (BcrB)

http://www.eternagame.org/game/browse/7113320/?filter1=Id&filter1_arg2=7120631&filter1_arg1=7120631



Second sub lab puzzle part part


I couldn’t find any of my designs or other denoted in this order, so I designed it denovo.


Acr

http://www.eternagame.org/game/browse/7113319/?filter1=Id&filter1_arg2=7206436&filter1_arg1=7206436


Fusion


To fuse the sub lab designs, i took the first B/C part that should go first in the order.


I froze the design to be able to easily delete all the static stem bases in one go. Then I did a copy.


ACAAACCAUCCUGUCUCUAGAACUUAGUCACCAUGGAUAUAUCAUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


Then I pasted the sequence into the DEC puzzle. I moved the puzzle part fully to the end of the design (removed that first loose A base).


Part fusionpng


I froze the A/C design to delete the static stem bases in one go.



Then I slided the whole design to the beginning of the sequence to be able to paste it like I wanted.


CAGUCUGUUCCACCUGUCUCGUGAAACACGGAAUUUAGUUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


After I unfroze it again. Sequence now slided to the beginning. Note that the structure is still stable while it does not fulfill all demands.  


Then I did a copy, called for the sequence stamper and pasted the sequence.


sequence stamperpng


Sequence entrypng


I specified sequence landing space to 46


Base positionpng


Total fusion after it has taken place.


CAAACCAUCCUGUCUCUAGAACUUAGUCACCAUGGAUAUAUCAUACAGUCUGUUCCACCUGUCUCGUGAAACACGGAAUUUAGUU


Since the intersecting solve style fills more than a design that is just overlapping its element, I needed all the place for the fusion I could get. So I have slided both sub parts as close to the end as I could get.


Normally I would also slide the two parts back and forth in relation to each other, to find a potential match between them. But there was no space this time. (I would like to see a fusion of two intersecting style solved sub part, but mostly I think we would run out of sequence space for that.)


The main thing is that if we have a working structure from an earlier lab, it is regularly possible replicating and doing something very similar and have a shot of making it work. At least in simulation.

(Edited)
Photo of spvincent

spvincent

  • 48 Posts
  • 9 Reply Likes
There's a lot of data in those spreadsheets. Is there any kind of guide to interpreting it? Or can you just look at a particular column (F perhaps) to get a sense of how good an individual design is?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Hi spvincent!

Your question got me inspired. I have started an intro.

Reading EteRNA lab data spreadsheets
Photo of spvincent

spvincent

  • 48 Posts
  • 9 Reply Likes
Thanks for putting that up Eli but it does raise some further questions. The Eterna score seems to be the sum of three components: Baseline subscore, Folding subscore, and Switch subscore. I'm curious what these represent and why the first two so often have a fixed value of 30. Also, it sounds from a comment by Omei that this Eterna score isn't all that useful when there are multiple oligonucleotides about. So what would be a good metric in this case: some function of those binding constants perhaps?
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes
The full data set is now available . Please use this instead of the preliminary one.
https://docs.google.com/spreadsheets/...
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

How matters the input to actual switching?


I have been drawing some of the majority types or solve styles present among the higher scoring A/C and B/C designs.


Now we have more data with the new reporter, I can say that the absence of MS2 and the presence of a weaker reporter instead, seems to allow more different solve types to happen. Still there are certain overall trends in the data. Solve styles that works better than others. I think that the MS2 in past labs had a habit of sparking certain patterns in the designs themselves.









What I find really worth noticing is that the winner in A/C DEC and the top scorer in B/C DEC do not solve in the same structural manner.


The A/C INC and B/C INC winners do have some of the same structural types, but do not have identical majority types.


Now why is that?



Structure recycling


I have been a strong proponent of reusing the same structure, even for designs with different inputs.


Recycling the structure of a good solve


I still am, however I have something to add.


While it will generally work well transferring a successful structural strategy from one lab to another and just refit the input - we have done so successfully many times - I also see another pattern start to occur.


I did structurally alike versions in all the Sensor RIRI labs - just with the input changing - however they don’t do equally well.


In both sensor A and C RIRI there are winners, however in sensor B RIRI lab the highest score was 81%


And I suspect this score difference is due just to their different input. As the input is the only thing that changes between them. Plus I nicked the starting structure from a winning design by Omei in a previous and similar lab - with an identical reporter!



Fold change and score


One thing worth noticing is that any lab that contains anything with a B input, trends towards scoring less well compared to the labs without it. (N.B. there are winners in several of the labs with the B input involved.)


Labs sorted by average score

Average scorepng


Also fold change trends towards being lower for the labs having a B input, compared to those without.


Labs sorted by average fold change

Foldchangepng




The nature of the inputs


So why are the Sensor B RIRI’s and some of the other B containing labs doing worse than their peers?


I think the reason for this, is that the input will have some force over what structure is needed. This is what I'm starting to see and have suspected. Each input is not equal and alike. While many will be.


The B input had lots of strong bases and in an equal distribution. It was more stem like in nature, not being microRNA like. MicroRNAs seem to have a bias. (At least those I have seen) Like more G's to C's or reverse - but not a balanced mix. They also seem to not to be too happy about folding with themselves - practically a function of said bias.


MicroRNA and entropy


So if an input gets too strong - having too many strong bases - compared to the other inputs, I think it will start affect things like fold change and score for the worse. Plus it should eventually be way too happy to fold with itself and also less willing to let go, when it first have attached to something other than it selves.



Perspective for switch inputs


Structure reuse between similar switch labs will generally work. But the input has some power too, dependent on its nature. If that nature is strong bases, things will get sticky. And other structural patterns will need to get played to get to a solve.


So basically I think the input alone is capable of sparking the need for a new kind of structural solve, if of a certain not so mellow nature.


It's fundamentally the same thing I think happened when it came to the change from the MS2 to the new reporters. But in this case the absence of the MS2, is releasing more options for solving structurally different.


Most of the labs I drew above use similar solving path ways, but they don’t get played in the same order, depending on what lab type and input is used. Yet a thing worth noticing is that the B/C DEC high scorer gets around the too strong B input by splitting it up in two and thus weakening it. A similar pattern can be seen in the ABC2DEC and A (AND) B - RI high scorer.  

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Eli, I strongly agree with what I think your main thesis is here -- there will be many useful structural patterns for switching, but the ones that work best for any particular puzzle will depend on how the input and output oligos/aptamers for that puzzle relate to each other.
Photo of Atanas Atanasov

Atanas Atanasov

  • 42 Posts
  • 15 Reply Likes
What is the concentration of the design RNA used in the experiments? And is KD measured in nM?
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
The design RNAs aren't in solution -- they are anchored to the chip.  It is Nando who figures out how to best apply NUPACK's folding engine to predict the results on the chip, and as far as I know, he hasn't written down the alchemy.

I do know that the KD values are in nM, though.
Photo of Atanas Atanasov

Atanas Atanasov

  • 42 Posts
  • 15 Reply Likes
Are the rest of the oligos also anchored or is it only the design?
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Only the design is anchored.  The rest are flowed in and flushed out as needed for the various measurement scenarios.
Photo of Atanas Atanasov

Atanas Atanasov

  • 42 Posts
  • 15 Reply Likes
Do you know what are the NumberOfClusters* columns measuring?
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Yes.  Preparing for the measurements is a complex process in itself.  But the basic idea is to generate little "clumps", or clusters, of RNA stuck to the chip, where each cluster is made up exclusively of one  unique design RNA.  This is needed because the microscope used to detect fluorescence isn't powerful enough to detect the glowing of a single molecule.  To generate a cluster, all the RNA designs are flowed over the chip and every once in a while, one sticks.  After about the right total number of molecules have stuck (something like a few million), that phase is complete.  The next phase amplifies each molecule "in place", forming a single cluster with enough copies to be seen in the microscope.  The cluster count for any design is the number of clusters that ended up being composed of that design.  If a design is lucky, lots of clusters clumps formed, and we get lots of data.  But if only a few clusters formed, the data we did get is not very robust, because there aren't enough raw data points to average out all the random experimental errors.
Photo of Atanas Atanasov

Atanas Atanasov

  • 42 Posts
  • 15 Reply Likes
Are DEC experiments influenced by reporter reversibility? That is, is the experiment with the lower concentration done first and then the same molecules that have already bound the reporter are used for the experiment with the higher concentration? Or are the two experiments completely independent?
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes
Good question regarding reversibility.
The reporter is a 10-nt RNA oligo. We expect it to be reversible over the time scale of the experiment, based on Round 98 experiments, but we may also analyze some preliminary data for the present round to verify this.

During the experiment, we increase the reporter concentration roughly every hour with longer incubation times at lower concentrations to allow the experiment to reach equilibrium. In practice, we introduce 0.09 nM Reporter, wait for 90 min, then immediately flow in 0.18 nM and wait for another 90 min. In other words, the concentration is always increasing without flushing out the reporter between conditions.

Now, for the inputs (A, B, and C), the situation is different. Because these oligos are ~20 nt, they are not necessarily expected unbind, since perfect complementarity would prevent them to come off over the course of a day without additional mechanisms (e.g., strand invasion). For this reason, we restart the experiment from scratch for each A B C combo, including the regeneration of RNA on the surface, and then collect a complete Reporter binding curve.
Photo of Atanas Atanasov

Atanas Atanasov

  • 42 Posts
  • 15 Reply Likes
Do you wait before you introduce the initial reporter? For example in the A/C cases, do you wait for A and C to bind to the design before you introduce the first reporter?
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes
Yes, we incubate for 20 min or so with the inputs (A and C) but without the reporter. In practice, the association of the reporter at low concentrations (<0.5 nM) should also be much slower than the association of the inputs, which are present at high concentrations (5, 50, 100 or 300 nM)
Photo of Atanas Atanasov

Atanas Atanasov

  • 42 Posts
  • 15 Reply Likes
Thanks for this additional information, this gives me some ideas about theories about what might be wrong with the simulation.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
RIRI labs

There are two designs in this lab series, one in Sensor A RIRI and in Sensor C RIRI each, with high fold change (200+).


What these two designs have in common, is that they both take advantage of a specific sequence stretch that is build into the input. In other words, something that is unique to that input for both its sequence and its position in the input.


In both designs this involves magnet segments. I think these aids the switch even if these switch also involves longer than usual switching stem area.


Thus I expect the structures for these solves will be harder to transport between labs, as the other sibling labs likely won’t have input that can satisfy these demands and may thus not allow for a similar solve.


However I find these designs very interesting. In that they may open the door for hitting high yielding switches for a particular purpose - by input sequence design. To get switches with high fold changes, we could could cut the input sequence in such a way that it gave us the wanted sequence element needed to make such a the switch more switchy. And even better if we already have a high yielding switch, as we can reuse the structure and get ideas from the input on which kind of sequence would be most successful.


Sensor A lab example, Score 100%, FC 210% (Nearest neighbor strand fold type)


Bob IIIpng

http://www.eternagame.org/game/solution/6892346/7076688/copyandview/


Switching magnet stem formed in state 1, highlighted with green (CU rich) and red (GA rich). Which is exactly the kind of sequence I again and again see involved in switching elements.


All of the reporter is hidden away in a hairpin loop (State 1) between the switching magnet stem. Most of the input A is packed away too. Only a little sequence is “dangling” in an internal loop. (also state 1).



Sensor C lab example, Score 100%, FC 268%

19_9_2016 Zipperpng

http://www.eternagame.org/game/solution/6892348/6917056/copyandview/


Also here the reporter is hidden away in a hairpin loop.


Here is an example that also uses similar approach. It makes the R fold with itself. But also take advantage of that the input complement batches up with the reporter for its turnoff and the input for its turn on. (Colored boxes)


Score 100%, FC 192%

AI - possibilitiespng

http://www.eternagame.org/game/solution/6892346/7038371/copyandview/


So this design structure above may be reusable in another lab, if the input has double C bases last or close to lase - meaning that the input complement would get double G as its first bases. (Another thing to take into account here is that the input seems to being able to slightly fold with itself - state 2 - 5’ tail. This may or may not be important for success also.)


Though I think the above design will be harder to make work in general with many different input types. Compared to Jumping jack style designs that seems to be more robust to changes. It is possible to make high scorers with different inputs and different order of input and reporter, just some lab designs suffer more in fold changes than others.


Basically using an input with similarity to an input that has already showed up in a winning design that has the lab conditions one wants, both replicating the design structure of the winner and the important parts of the input sequence (like magnet segments used or sequence area that has high switchability potential), will allow us to make more high fold change candidates.


It is not just the structure that needs to be the same across designs, to some degree, important regions of the input also needs to be the same to have a similar function. By designing the input by actively choosing it such that it resembles earlier successful inputs, I think it much will raise chance of succeeding again with a similar structure.



Sum up


My main point is, that if a winning design in its input has a magnet segment (or an otherwise switchability enhancing sequence) at particular spot, which is involved in the switching area, then that design structure is more likely to be reusable in another lab if the input in this other lab also carries a similar magnet segment at a similar spot.



Structure overview


Structure overview of some common high scoring types. NB, there are more than usual. I think the this weaker reporter, compared to the MS2 reporter, allows for a lot more structures to be legal.




Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes
Sorry for the mistake. The excel and google sheets have been corrected (I hope).
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Np at all. Big thx for the update. :) Here comes a fusion table version of the data:

ABoverC^2_results (R104) - Last update 3 Oct 2016
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I think there still is a problem. From what I understand fold change for B/C DEC should be KD100nM_B_C/KD5nM_B_100nM_C. Just as fold change for A/C DEC is KD100nM_A_C/KD5nM_A_100nM_C. But it looks like the fold change for B/C DEC still gets calculated as KD5nM_B_100nM_C/KD100nM_B_C, which is the same as for B/C INC.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Thx for the fix :)

Here comes a fusion table with updated B/C DEC scores:

ABoverC^2_results (R104) rev. 3
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I just want to point out that Omei's suggestion with rerunning failed designs under the lab where they according to their numbers would do best, worked like a charm.

As expected it has speed up the generation of winners hugely, especially for the sublabs as those were of main focus for this.

I can hearby say thanks for all my fine RIRI and RIRO winners. Anyone of them carrying the hashtag #recycling is thanks to this. :)

It would be smart if these designs were picked out automatically and run along with an new round.

Else a spreadsheet as the one Omei made, that allowed us to pick them out would be great, not just for recycling but also for the purpose of analysis.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Jumping jack style designs


I mentioned that my Omei inspired jumping jack series and their derivatives got different scores, just depending on which lab they were in. So the same structure was general doing well in all labs compared to their mates, the designs did not do equally well on score or fold change. (not fully identical but overall similar structure). Something I think is due to their difference in input sequence.



Sensor A - RIRI, 93%, FC 35%

Sensor A jumping jackpng

http://www.eternagame.org/game/browse/6892346/?filter1_arg1=6982712&filter1=Id&filter1_arg2=6982712




Sensor B - RIRI, Score 80%, FC 9%

Sensor B jumping jackpng

http://www.eternagame.org/game/browse/6892347/?filter1_arg1=7090795&filter1=Id&filter1_arg2=7090795


But despite the B lab getting lower scores, the jumping jack style still got 3 highest score in that lab, something I think hints at that it is more a problem of the B input than the structure itself.



Sensor C - RIRI, Score 100%, FC 97%

Sensor C jumping jackpng

http://www.eternagame.org/game/browse/6892348/?filter1_arg1=6924111&filter1=Id&filter1_arg2=6924111


Second best fold change in this lab.



Now these designs are inspired by Omei’s winner. They are not as the originals. Had they been, they would have likely done even better. I reversed the reporter and input in order.


Also there is one more thing that is not there at the same spot - is something that is in the sequence of the input in this earlier lab. The inbuilt magnet sequence.


mRNA-in, reporter-in, Score 100%, FC 354%

Omei jumping jackpng

http://www.eternagame.org/game/browse/6116602/?filter1_arg1=6143292&filter1_arg2=6143292&filter1=Id


Now I did get the general design structure working (while reversing input and reporter), so it can clearly work without that magnet segment, I’m just sure it will work better with. :)


I still think jumping jacks style design will be generally easy to make work also with many different kind of inputs. I think they may be a little less input sensitive than other structures - although they will prefer a magnet segment too at a specific spot in the input sequence too. Despite they didn’t get that and that I reversed the order of the reporter and input compared to the originals, they were still doing fairly well in the RIRI labs.


So this is basically exactly the same story as the one on the high fold change designs just above. Just with a different design from an earlier lab. And even better fold changes.


May you keep your switching areas rich in GA stretches, CU stretches and if you need need to move a switch mountain of stems also a long region gliding GU stretches :)

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Prediction for RIRO labs

I was making a prediction for the round 1 RIRO labs. I was expecting the Sensor C riro lab to behave better than the Sensor A and Sensor B lab.


I was basing this based on behavior I have seen in labs with designs with direct overlap between their input complement and reporter in exclusion labs and a hypothesis that it is better to have the leaving input before in sequence than the staying input.


The Sensor C did indeed do better (count = winning designs), with the most winning designs compared to sensor A and B. Both Sensor A and Sensor B managed to get winners too.


Fold changepng



Now this overview don’t tell the whole story as some of the designs are of different kinds.


So instead I compare for the winning designs across these sensor RIRO labs that used partial overlap between reporter and input. Which are those designs I’m interested in comparing.


Sensor A - Two winning designs uses direct overlap in non preferred order (FC range 60-91%)

Sensor B - Five winning designs uses direct overlap in non preferred order (FC range 42-46%

Sensor C - Fourteen winning designs uses direct overlap in preferred order (FC range 39-205%)



What else happened?


Sensor A got the overall best fold change 281% for all 3 labs - with a non overlapping design - intersecting style. This design had several siblings, raising the overall fold change average of this lab. Highest score in Sensor A lab with an overlapping solving style was 98%. (Order Staying sequence before leaving sequence)


Sensor B used direct overlap but with staying input before leaving input. None of the fold changes were impressive. But this may also account to the strong input B both for binding too strongly when first attached, but also likely being way too fond of binding with itself thus taking a long time to bond. Something that shows up as high KD on for the B input in particular.


The majority of the Sensor C winners used a partial overlap with the order that I prefer. Leaving input before staying input.


So while we still have very few winners for RIRO labs, judging from the amount of winners and fold change, it looks like there is a preferred order.



What could we use preferred input order for?


If this trend with better fold changes for input/reporter overlaps with leaving sequence before staying sequence continue as I expect, then we can play this to our advantage.


To simply know when we have inputs that can not be made overlap in preferred order, then we should instead aim for strategies, like intersecting inputs or spreading out the inputs in the sequence, to raise our chances of hitting a better fold change.


Intersecting style is starting to show great promise too. Especially with the reporter packed away in the middle of the input. This type of exclusion strategy may end up getting us even further than a more direct overlapping exclusion.


But for now it looks like simple labs with two states, 1 reporter and 1 input, where reporter is on in one state and input in another, that these exclusion type labs benefit from a specific order of overlap. They are still among winners, even if overlapping opposite way. As they have been before too.


So if reporter and sequence are a good fit in preferred order overlap, they will be easy to make work. But if they don’t, switch strategy.


Overlapping style designs with direct overlap, with staying input before leaving input. (non-preferred)

Direct overlapping designs, with staying input before leaving input (non-preferred)



Direct overlapping designs, with leaving input before staying input (preferred)

Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
congratulations on a convincing test of your prediction!  I'm still getting my head around how you predict the sequence ordering of the elements, but this helps a lot.
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
any predictions for the distinct A, B, and C sequences for OpenTB round II?

for others tuning in... I think you & players proposed those sequences, which require a choice of a subregion from a very long gene. So did those round ii inputs have more sequence similarity (or complementarity) to the RNA-out oligo or to each other and if so, which single, double, and triple input designs are more likely to succeed?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Rhiju, thx!

Now I have some input behind the why. It has to do with KD.


Put leaving input before in order than staying input

I started to wonder if the order of inputs would affect KDON. I checked and the answer is yes.


While I first observed the benefit of putting the leaving input before the staying put in designs where these sequences overlapped, there even seems to be a preferred order even when the inputs are not overlapping.


  • The order of the inputs affect KDON

  • Leaving input before staying input → lower KDON

  • Staying input before leaving input → higher KDON


Clearest I can show this difference in the A/B labs with the inputs in predetermined order.


Leaving input before staying, general lower KD, lots of winners

Predetermined fold changepng



Leaving output before staying, general higher KDON, fewer winners

Predetermined alternative fold changepng


If KDON is 15 or below things are fine. This means the design gets a top points for the baseline score (Which is max of 30 points of the total score).


The A/B lab with alternative predefined binding which has the fewest winners of the two, also has the highest KDON. Most of the winners are not getting full baseline score.


Yellow stars marks the designs that do not use direct sequence overlap and that are therefore not relevant for what I’m interested in.


First the designs sorted after fold change. Notice that Sensor C lab with preferred ordered input, pops out at top.  

Sorted after foldchangepng

NB, I got the Ro lab somehow smuggled in my data search below. But since it’s highest scores are in the 80’ies, none of the design will pop up since my score limit was 94%. So ignore the RO bit. :)


Now I sorted the designs after KDON. What stands out here is that the Sensor C designs (preferred order) have generally lower KDON compared to both Sensor B and A. (non preferred order)


Now the Sensor B lab are not any anywhere near the critical KDON 15 limit, Sensor A is. It was possible making winners in all labs, although not equally easy. But for labs that have their KDON close to the limit, having the input in an order that do not additionally raise KDON, could be critical.


Sorted after KDONpng



For the Sensor A designs like Run 1 with really high fold change, they have an intersecting solve style, where the reporter is hidden in between, two halves of the input. I expect this style to grow strong for round 2. This design also have a low starting KDON. (1.11 - whereas many of its winning peers had way higher KDON) So there are different ways of lowering the KDON so it gets in a range that is suited for what input one has got and to get beyond its inbuilt limitations, like non-preferred order.


I think we can use the KDON as a predictor of which designs are worth modifying to make winners faster. It allows us to get a preview of which inputs to put in what order. And where there is room for improvement. Even more - it can help us tease out strategies to get designs that are close to what we want, in the wanted KDON range for success.


Like the Sensor A designs that will trend toward having a too high KDON, if solved with sequence overlap in non preferred order, but are more likely to get staggering success if solved as intersecting style, as this allows for a far lower starting KDON.
Photo of jandersonlee

jandersonlee

  • 549 Posts
  • 122 Reply Likes
I'm amazed at how low KDON can be in a working OpenTB Round1 design. It seems that the valid KDON range is lower for OpenTB than it was for the MS2 labs. Low KDON means the design needs less of the Reporter (lower concentration) to signal an ON condition. Perhaps this is mostly related to the binding affinity of the Reporter oglio we used in OpenTB Round1 (lab 104) versus the MS2 binding affinity.
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes
Yes, it's due to the new reporter. Expect the new, longer reporter in the next round to bind even tighter.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Riboswitches - it’s all about the symmetry...


When symmetry is bad for static RNA designs as it causes misfolds, the logical conclusion follows that symmetry is good for riboswitches that needs to get moving...


Image taken from an earlier Riboswitch on a chip analysis post. Notice that the top left image which is close to a mirror image of itself, also has the biggest fold change.


While the ON state seems particularly fond of symmetry, I even think that if one makes symmetry in both states, there will be double bonus.


(Image recycled from the Same state 2 which is the most successful Riboswitch on a chip lab.)


We can use that riboswitches seem to dig symmetry or near symmetry, to take better aim at the target. 

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
It's still there.  I suspect you're getting fooled by the fact that at a certain point getsat starts putting new replies on a second page.  Scroll to the bottom of this page and you'll see.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
@Omei: Thanks, that was where my post was.
I was able to find your example in my e-mail account.  I get all new posts to that account.
Seeing your example, now I totally see how scores could be so low in the AB/C-INC lab.  
All of my reporter attractor strands had unbound bases in a loop in state 3.  
Even though a few only had 3 or 4 unbound bases, most has 5 or 6 and that seems to be what is happening.  The reporter can attach even with only 3 or more bases unbound.  
Even though the lab folding engine thinks having the reporter attractor strand in a loop of a hairpin is enough to keep the reporter from bonding, lab results say it is not oK.  
Well done! 
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
@Omei: Thanks, that was where my post was.
I was able to find your example in my e-mail account.  I get all new posts to that account.
Seeing your example, now I totally see how scores could be so low in the AB/C-INC lab.  
All of my reporter attractor strands had unbound bases in a loop in state 3.  
Even though a few only had 3 or 4 unbound bases, most has 5 or 6 and that seems to be what is happening.  The reporter can attach even with only 3 or more bases unbound.  
Even though the lab folding engine thinks having the reporter attractor strand in a loop of a hairpin is enough to keep the reporter from bonding, lab results say it is not oK.  
Well done! 
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
Sorry, don't know how I double posted :(
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
Just looked at my AB/C-DEC lab and the reporter attractor strand is mostly in a loop in state 4.  If an unbound reporter attractor strand is bad for INC, why was it not for DEC?  This is getting curiouser and curiouser :)  
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Get free royal flush for lab

Omei has made several observations that I consider crucial for making better lab designs. I have written an intro to his ideas plus to the switch graph. Spvincent has been making good questions again. :) I haven’t got them all covered. The intro is a work in progress.  





Here are the main points I will cover:

1) Coaxial stacking is helping reporter binding. Omei has observed NUPACK wrongly scores a design less favorable when the reporter is right next to one of the inputs. But he suspected that this would be more beneficial and made a lab experiment to demonstrate.

The designs that had the reporter closest to the input got a lower and better KDON. Coaxial stacking gives the reporter a better chance attaching at low KDON, something that will raise fold change potential.)

2) The fluorescent tag is affecting our experiments.

Omei is hypothesizing that the fluorescent tag on the reporter is influencing our experiments.

The fluorescent tag is attached at one end of the reporter. What Omei hypothesize is that the difference there was in his experiment with the reporter having either its 5' complement or it's 3' end next to an input, is due to the fluorescent gets in the way of optimal stacking.

We didn't knew which end of the reporter carried the fluorescent tag. But we decided to take a stab at guessing which end the tag was placed.

Omei placed our bet with Johan. And we won! 5' end it is. :)

3) The fluorescent tag is affecting input order.

Omei also thinks that the fluorescent tag positioning could be responsible for the pattern I have observed, that one input takes preferred order compared to another. As mentioned in the post Prediction for RIRO labs.

The order I claim is the preferable with leaving input before staying input, is exactly the one that buried the area with the fluorescent tag deep.

I added position of the fluorescent tag in on parts of images from the above mentioned post to illustrate.

Sensor A RIRO example with staying input before leaving input (non preferred order) + tag (not buried)

Sensor A flourescent tagpng

Sensor C RIRO example with leaving input before staying input (preferred order) + tag (buried)

Sensor C flourescent tagpng

4) Reporter binding is influenced by base sequence after the reporter.

I noticed something funny. A good deal of the best designs have either an A or a G after the reporter complement where the fluorescent tag is attached...GAACUUAg or ...GAACUUAa. (Big bulky purines - guessing perhaps via their size or electronegativity having a role in pushing the fluorescent tag off while not strong enough to prevent it from binding if it has access to the rest of the reporter). If one instead searches with U or C at this position there are far less designs doing well, neither on score or fold change. It even appears this work if slided a base. So either two AA's after the reporter input or two G's. Even a G two bases away seems to have a similar effect, sometimes even if there is a C before.

There even seem to be a similar pattern too at the 5' end of the reporter input, with A in particular but also G doing well before the reporter input, but that bit is not yet as clear.

I noticed this pattern, after I did a pull of the designs in the TB round 1 lab that had the lowest KDON, among which a bunch of winning acinc designs turned up, that had their reporter right next to the input (supporting evidence for Omei's coaxial stacking idea).

Flush stacking - reporter next to input



G base at 85 after the reporter.

I also noticed that these same low kdon acinc winners with best fold change had a G after the reporter input. Second best fold change had an A. That got me curious and I started to look into if there was a pattern. Which there were.

Omei added supporting evidence for my idea:

"Last night I observed that a series of A AND B designs had an inexplicable (by me) high KD_ON value. And what the highest ones seemed to have in common was a C just after the reporter complement."

I hadn't identified the C and U's as higher KDON's, just as worse scores and fold change.

Advice for this round

1) Place the reporter in such an order that you can quench (kill!) the end carrying the fluorescent tag, when it needs to be turned off. This can be done either by direct overlap with an input, sequence targeting this reporter end for turnoff or by a base sequence after the input with a calming effect.

2) Drag the reporter closer to an input to allow it to coaxial stack.

3) Also I will love to see loads of experiments with all possible base combinations 1-2 bases after the reporter complement in good and close to good round 1 designs. (And similar for the base area right before the reporter complement). So we can better understand what effect the fluorescent tag has on our results.

As Omei says: "We should focus on understanding what affect the Cy3 really has. So maximizing the score for the Cy3 may or may not be a good strategy. But understanding how big an effect it has will be important knowledge for making progress, regardless.
(Edited)
Photo of jandersonlee

jandersonlee

  • 549 Posts
  • 122 Reply Likes
The old lab data browser had a way to sort the data via distance (number of base changes) from a given design. Is that data browser available to use on the latest lab data?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Yup, it is. Here is how to get to it:


Getting to the Classic data browser

I am basically wishing for something similar to be possible in the new browser, but in a more fine grained way.
Photo of Hyphema

Hyphema

  • 91 Posts
  • 25 Reply Likes

I'd like to throw in a thought!  I have been trying my best to keep up with your posts and there is an idea that has been loosely suggested but seems to have died down a bit.  As a player with less and less spare time I am interested in seeing a short list of "promising" sequences that the devs or other players that would like to be "improved" for the next round.  It would be awesome if I could just go to this proposed list and then click on a sequence and then start to mutate and then submit.  For instance, perhaps a player (ie Eli) could propose an idea for a set of sequences to be mutated.  I could read his thoughts then start working on it. Just a thought. Still very much interested in helping. 

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Great suggestion, Hyphema.  What do you think about starting a new topic, so they don't get lost in this one, which is getting quite long.  And although it wouldn't surprise me at all if Eli were the first to jump in, I think any lab player should feel free to add a suggestion. And if said player explains why they think the design merits mods, all the better. :-)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I got the post started.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Riboswitches as 3D stereogram

While I was watching the first round ABC2DEC lab results, it occurred to me that I could probably see 3D imagery of it if I tried.

Here is why I found it worth trying.

The best scoring designs are fusion style solves. A solve type that Atanas came up with, where one half of the puzzle is the smaller B/C puzzle part and the other half is the smaller A/C puzzle part. These two halfs are very similar in solve pattern, meaning they are alike so much as they can mostly be overlapped. (Demonstrated how to fuse two such puzzles here).

Now the B/C and A/C part don’t have their inputs in exactly the same order, while they are close. The B/C part uses intersection which the A/C part doesn’t.

I did a raw view of the top scoring designs and there definitely is some 3D stereo effect.

Stereoeffectpng

However to give it a better shot, where the designs are lined up vertically, I did a sorting after the top scoring design. This gave a better 3D view.

DEC sortpng

So I can only imagine that a version where all elements in the half parts are in same order, should create an even better 3D image. :)

A stereogram will only happen if there are repeat elements and sequence.

Quote from WIKI:

“When the brain is presented with a repeating pattern like wallpaper, it has difficulty matching the two eyes' views accurately. By looking at a horizontally repeating pattern, but converging the two eyes at a point behind the pattern, it is possible to trick the brain into matching one element of the pattern, as seen by the left eye, with another (similar looking) element, beside the first, as seen by the right eye. With the typical wall-eyed viewing, this gives the illusion of a plane bearing the same pattern but located behind the real wall. The distance at which this plane lies behind the wall depends only on the spacing between identical elements.”

I wondered how the data of the high fold change double aptamer riboswitch by PWKR that I had accused of near symmetry (in the above post) would look.

Double aptamer with stereo effect

Double aptamer stereo imagepng

And it results in an even stronger 3D stereo image. :)

Now I wonder, can bots see stereo images? Basically I wonder if one can get them to search for potential riboswitches in data. :)

Which made me wonder if one can also see stereo images in classic eterna data. And one can.

At least if one pick one of the more symmetric puzzles like the Star. And it is pretty easy in the Branches, as this lab basically is all repeats and symmetry. The closer the repeats are to each other, the easier they are to make a stereo image.

Even the grid and small letters repeated horizontally should be enough to create some stereo effect. But when letter sequence are repeated, it will create color overlap too, which will enhance the stereo effect.  
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Cy3 + Reporter + RNA design =  It’s a circuit!??? :)



I can't help thinking when looking at that Cy3 dye in the paper from Johan that Omei mentions, that it looks like something with potential for being a wire. Like resonance structure as in a conductive polymer.

Short resonance structure. Electrons moving around so the double bonds shift position.

Resonance structurepng

Plus DNA wires are possible. :D Which is wicked cool and something I had been wondering about - okay more about if RNA could be conductive. Anyway - close cousins. :) Here is the paper I dug up.

Now as the Cy3 tag can floures, a resonance structure and a running stream of electrons in the dye would make sense.

However I think this go further than just a small localized wire. I can’t imagine the Cy3 and reporter bound against the RNA, without thinking about an electric circuit.

The first and foremost resonance structure I learned about is the benzene ring. Basically it is a very stable 6 carbon ring, with delocalized electrons whizzing around.

There is something else containing aromatic rings. RNA bases have them, just as DNA bases.

The Cy3 has two aromatic rings and these rings can be stacked on top of the RNA bases. And from what I get from the paper from Johan:

“NMR structural experiments established that both Cy3 and Cy5 dyes are mostly stack onto the terminal base pair, in a similar orientation to an additional base pair [44] and [45].”

So basically Cy3 could stack it’s “base-pair” on top of the RNA basepairs and become part of the temporary stem formed by the RNA and the reporter binding.  

I’m aware that RNA is way more unstable than DNA and as such current will have a worse chance of transferring over a longer distance. But I think short distances could be enough to enhance fluorescence and/or affect RNA folding.  

Jumping electrons

Basically I think there is an interaction between the aromatic rings that involves electrons. One thing I took note of in the paper:

"Typically, annealing of the probe to its target alters the fluorescence properties of the cyanine-labeled oligonucleotide."

This I read as a potential circuit may get electrons from somewhere else or lose electrons to somewhere else.

Here the bases are seen from a side view.



I have no idea which way the electrons could run. But I hope you get the idea.

An electron can jump from the electron sky around an aromatic ring to the next, if they are stacked on top of each other. So I basically see the fluorescent tag as closing the circuit.

Which lead me to another thing I have been wondering about. If an electron could pass through a hydrogen bond. Also I started thinking about quantum tunneling. Since there is no other connection at the other end of the Cy3.

I read a very interesting paper, that says that just that can happen. Electrons do prefer to jump between rings stacked on top of each other, but they can jump too between aromatic rings in different strands. (Fig 3.)

“Thus, ET (electron transfer) proceeds preferentially down one strand in double-helical DNA.”... ...If H-bonded basepairs must be traversed the ET kinetics slow considerably.

Electron Transfer Between Bases in Double Helical DNA (Sorry, paywalled)

Electron donor and acceptor in the DNA base world

I learned one more hilarious thing. Even DNA bases can flouress - or rather slightly modified versions of Adenine. :D

These artificial fluorescent Adenines fluorescence can be quenched by a Guanine and another fake base.

“The fluorescence of both of these bases is efficiently quenched by deazaguanine (Z) and guanine(G), with only small amounts of quenching observed with inosine(I) and the other DNA bases with significantly higher redox potentials.”

(From above mentioned paper)

Guanine and Adenine (mutants) can behave as electron donor and electron acceptor.

Guanine - donor acceptor

Adenine - electron donor

(From above mentioned paper)

And when I look at the G behavior after the reporter complementary site, I very much see quenching behavior. That’s what I seen from the start, I just mainly attributed it to Guanine size and it taking the spot so the tag couldn’t get a good grab at this side of the strand.

Will be interesting to see if the Guanine quenching trend after reporter compliment continues.

Guanine as quencher

Perhaps this could be reason why GU’s and mismatches are less welcome inside the reporter stretch is that not only do they prevent the reporter from binding well, but also the geometry disturbance prevent the electrons from flowing.

“Moreover, a profound sensitivity to stacking has been observed; in the present of base mismatches or other stacking perturbations, long-range ET (electron transfer) is essentially turned off.” (From above mentioned paper)

In that case it would make sense why even input complement sites can be affected too if they are close to or next to the reporter.

Since G can be a quencher (electron acceptor) in DNA, I wonder if it can also be an electron donor?

Reporter bases, the complementary bases, neighboring bases + even further away bases, affect glow

I think this circuit is affected by base sequence. The paper Johan shared, says something about sequence affecting stability.  

The paper says” The magnitude of stabilization depends on the base sequence”

There is also a geometry angle to it. The aromatic rings are stacked in RNA - they are lined up for electrons jumping through the aromatic rings. Or almost. Purine and pyrimidine bases don’t have the same size.

Top drawing I have tried illustrate the size difference between bases.



Bottom drawing: I suspect electron transfer would work better in particular if the same kind of base is on top of each other. Like purine on top of purine or pyrimidine on top of pyrimidine. And even more so if the same kind of base is stacked on top of itself. Like in poly(A) or Poly(X)

Here is a paper that seems to be saying something similar about DNA.

The common model for electron transfer through DNA is based on overlap between p orbitals in adjacent base pairs[14]. Irregular base-pair sequences may lead to localization of charge carriers and reduce the transfer rate of electrons[9,15]. A structure containing a single type of base pair may therefore furnish the best conditions for p overlap.

Direct measurement of electrical transport through DNA molecules

I think the base type difference between the reporter could create a potential differential. Just voltage difference is needed in an circuit to get current flowing.

I think our lab results will differ just depending on if the reporter mainly has a purine bias, a pyrimidine bias or a more balanced base distribution. I strongly suspect this will affect the reporter binding and KDON values. I don’t think that every reporter will be equally good. I simply think that the individual kinds of bases affect the electric conductivity and circuit that I strongly suspect occurs, when the reporter and the Cy3 fluorescent tag together bind up with our RNA design.

What I think is that the reporter or part of it along with the tag functions as a circuit and this somehow affect how well the reporter will bind and how much it will glow.

Even more extremely if the reporter itself and its landing site were pure poly(X)es.

I think cytosine and uracil are bad conductors, since they are smaller and more unstable - wiggly.

However I think guanine and adenine are better, since bigger bases are more rigid.

Poly(A) and super positioned electrons?

This thing with electron flow may potentially have implications for the strange poly(A) pattern that turned up in some of our classic EteRNA labs.

And since I have recently got a crush on quantum mechanics, I can't help see quantum tunneling and a standing wave of electrons, through the poly (A) stretch. Perhaps even the weird break in pattern could be reflection.

However the weird poly(A) pattern dies if interrupted by any other bases than A. (Any base change would affect local geometry)  

The poly(A) structure is different in that it do not seem to be part of what seems a circuit. There is only a single stranded RNA.

Polymer conductivity

My sum up of what is needed for polymer conductivity based on the book: Polymer chemistry - An introduction, Third edition, page 117-118

  1. Delocalized electrons. For backbone to get conductive a larger range electrons

should be delocalized to be able to form a long resonance system.

  1. Doping - something that in chemical world can be done with metal.

  2. Geometry matters. The more rigid, the more crystalline


  1. In other words stacked aromatic rings could allow electrons to jump from ring to ring + some quantum tunneling (quantum coherence) should an interstrand jump be needed - and thus enhance glow.  

  2. Our RNA’s bathe in MG2+

  3. I suspect Poly(A) will do very well on being crystalline.

(Edited)
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
Hi all OpenTB reviewers -- the experimental team is considering revisiting how we compute the overall eterna scores for these challenges to better reflect what would be useful in a diagnostic device. It would help us a lot of we had a few examples that might have misleading scores.

Did you notice any designs for A*B/C*C that looked promising but give poor scores? Or vice versa? Even 1 or 2 designs would help us. 
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
Also, regarding concentrations to use, experimental team has talked about it -- it will turn out to be difficult for us to change the experimental concentrations from the in-puzzle concentrations in the next round, due to the cost of doing experiments.

However, we will likely do a 'big experiment' on successful OpenTB designs in 2017 to support publication of the experiments and so that collaborators working on paper devices will have a detailed 'response curve' for the RNA designs that we pass on to them. At that point, the experimental team will be taking into account detailed discussions we've been having with players, particularly Omei, and will likely ask the community for more advice.
Photo of mat747

mat747

  • 130 Posts
  • 38 Reply Likes
@rhiju
We need more colour options for highlighting nucleotide in the lab.
Having the black ring is very useful and it was a good start, but is not enough for the TB labs.
I'm sure you having been enjoying all of the different colours Eli's uses to highlight different areas/inputs of nucleotide in his example images.
More colours would make designing and following analysis easier.
Photo of Hyphema

Hyphema

  • 91 Posts
  • 25 Reply Likes
rhiju,  i have to agree with mat.  There are multiple avenues to look at when modifying a sequence and i need to follow the changes that occur in each state.  So choosing a color for marked nt's would be helpful.  If ctrl-click highlights then maybe i could click more than once to toggle through colors??
(Edited)
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes
I like the 3D plots. It should be possible to generate them for the next round.
Photo of mat747

mat747

  • 130 Posts
  • 38 Reply Likes
I think the short cut keys for controlling the highlights could be Ctrl +  (Number) + click. 1 to 10 would give us a good range. 
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Quantum entanglement in partner labs


I have been making sum ups of different switch labs through time, when I found a pattern that I thought applied. However I have long been having a feeling that there was a more general pattern, across whichever reporter and input was used.


I already mentioned that for the logic gate labs, it seemed as if each lab had its reverse partner. Like the AND and NAND labs. The AND winners would have their RNA inputs exactly opposite in order to those in NAND. (See examples at bottom of the post)


Partly due to that our new reporter allow for a lot more variance. Also I had trouble digging it out due to confusion about what was an ON and a OFF switch.



What is an ON switch, what is an OFF switch?


I have ended agreeing with myself about that an ON switch is all switches which have its Reporter binding in the last state. Similar an OFF switch is a switch which has the reporter not bind in its last state. No matter how many ON or OFF states there are besides.



Partner labs and input reversal


The idea is that if you know the favored input order of one lab - you know the favored order for the partner lab too. Even just knowing what type of lab it is, already helps. If you know if you are solving a single input OFF switch, you also already know something about what it likes - like getting the input placed at 5’ end.


Usually ON switches score better than OFF switches.


Omei have noted that the OFF switches tended to have a higher KDON than ON switches.



I have highlighted (yellow) a few cases that did not follow the general pattern. The two first, I suspect being due to the strong input being really strong and as such not care as much about where it lands, compared to a weaker input. The last highlight I have no idea why.


I have looked at the main trends inside a lab - meaning it is possible finding winners that follow a different pattern, I have just cut out the main trend.



Partner labs - Example images from Logic gates lab  


Notice the reversed inputs between the labs. Both designs are winners. And they each do the opposite RNA math of the other.


OFF switch, MS2 is off in state 4 when both inputs bind

http://www.eternagame.org/game/browse/6434644/?filter1_arg2=6612031&filter1=Id&filter1_arg1=6612031


ON switches, MS2 is on in state 4 when both inputs bind.

http://www.eternagame.org/game/browse/6434647/?filter1=Id&filter1_arg1=6471708&filter1_arg2=6471708





(Edited)
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
this mirroring is a striking observation. I'll be interested in seeing if the idea holds up in the Round 2 results...
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Mirror entanglement still happening

I mentioned above that there were strong trends for which input to go first and last for on and OFF labs, just depending on the relative strength of the inputs against each other.



Input difference

One thing that was different between round 1 and 2 are the reporter inputs. I have been saying that the round 2 inputs are more even in strength. Really they are more similar to each other in content. But the A and B input are actually reversed in strength.


Round 1 (C rich)

A - 10 strong bases, 8C, 2G

B - 11 strong bases, 5C, 6G (strongest)

C - 10 strong bases, 4C, 6G


Round 2 (G rich)

A - 11 strong bases, 4C,7G (strongest)

B - 10 strong bases, 2C,8G

C - 10 strong bases, 2C,8G


Basically the A and B input were reversed in strength between round 1 and 2.



With the weaker bases included


Round 1 (CU rich)

A - 10 strong bases, 8C, 2G (3U, 3A)

B - 11 strong bases, 5C, 6G (strongest) (8U,1A)

C - 10 strong bases, 4C, 6G (9U, 1A)


Round 2 (GA rich)

A - 11 strong bases, 4C,7G (strongest) (2U,3A)

B - 10 strong bases, 2C,8G (7U,3A)

C - 10 strong bases, 2C,8G (3U,7A)


Global fold (GF) change versus local fold change

For round 1 the hard DEC lab generally had the B input (strongest) before the A input (weakest) for the higher scoring designs.


Round 1 hard dec with highest GF, Score 73%, GF OFF 2.07

Fisker strongpng

http://www.eternagame.org/game/browse/6892314/?filter1=Id&filter1_arg2=7034986&filter1_arg1=7034986


This trend with B before A still continues for the main part of the designs with highest fold change despite input strength reversal. (See the hard DEC images sorted after fold change)


However when sorting the designs after Global fold change, the design scoring best follow this trend I highlighted in the post above, with the strongest input being first for DEC.


So it seems that while B before A for ABC2DEC is best for the local concentration settings for the puzzle, it isn’t so when it comes to the global fold change.



Round 2 hard DEC with highest GF, score 95%, GF OFF 4.85

Andrew strongpng

http://www.eternagame.org/game/browse/7113332/?filter1=Id&filter1_arg2=7233512&filter1_arg1=7233512


Summed up: The B input (strongest) was before the A input (weakest) for the round 1 hard DEC GF high scorer, where A input (strongest) was before the B input (weakest) for the round 2 winner. Which is the same order for the inputs based on strength.


This is continuing the mirroring that I described in the post above.



Hard INC designs with best global fold change

Similar the A input (weakest) was before B input (strongest) for round 1 hard INC GF high scorer, while the B input (weakest) was before A (strongest) for the round 2.


Round 1 hard INC design with highest GF, score 37%, GF ON 2.03

Fisker weakpng

http://www.eternagame.org/game/browse/6892317/?filter1=Id&filter1_arg2=7001278&filter1_arg1=7001278


Round 2 hard INC design with highest GF, score 49%, GF ON 1.76

Harry weakpng

http://www.eternagame.org/game/browse/7113337/?filter1=Id&filter1_arg2=7252060&filter1_arg1=7252060



Mirroring for sub labs

Also the Abro and Abri high scorers follows do the mirroring plus also follows the trend with input reversal for round 1 against round 2. Following that of the strongest input being first (5’) for OFF switches (Abro) and strongest being last (3’) for ON switches (Abri).


Abro has A (strongest) before B (weakest)in round 2, versus B (strongest) before A (weakest) in round 1.


Abri has B (weakest) before A (strongest) in round 2, versus A (weakest) before B (strongest) in round 1.


Not all labs do direct reversal of inputs. The reporter and input for the sub labs in the ACDEC and BCDEC, now generally trended towards having reversal of input and reporter (indirect input reversal) when comparing round 2 against round 1. This doesn’t hit fully through for the INC ones. A new trend for round 2 is that ACINC and BCINC trended towards having intersecting solving style.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
More advice for this round

Here are some things I think will work and help us get better designs. I think Input order, symmetry, structure repeats and state repeats will be key.


1) Input order

Have the strong B input before the weak A input.

- The ABC2DEC highscorers seem to prefer this order and so do the simpler ABRO variant. (OFF labs)

Abro variant, score 80%


ABRO overview



Have the weak A input before the strong B input.

While it is currently not the case, I expect the comming ABC2INC high scorers to have the opposite ordering of the A and B inputs of the ABC2DEC lab and follow the trend that pops up in the simpler ABRO variant. (ON labs) The ABC2INC design that Omei picked out as doing well on all concentrations, follow this order.

Abri variant, second highest score 80%


ABRI overview



(More about input order)



2) Symmetry

Many of the highest scoring designs for round 1 of the TB lab show a strong dash of symmetry. (Particularly for state 4, but also state 3.) The same is the case for a good bunch of winners from earlier switch labs.  ON switches tend to show stronger symmetry than OFF switches.
(More about symmetry)


3) Repeat states

Spvincent asked me a question in relation to why I in particular liked one of his hard DEC lab puzzles. (I like the whole series) As for the discussion to benefit all, I bring it up here.

Here is what he said: "Tx Eli but I'm intrigued why this design might be promising. For these 4-state A*B/C*C puzzles I've been trying to arrange things so that each state has a different secondary structure (is that the right term for RNA?). It seems natural and more appealing aesthetically. Yet here, as is the case for many other published solutions, the first 3 structures are identical."

Yup, you got it exactly right with secondary structure.
 
It is also great that you create a huge variation in your designs. Spreading your investment.
Actually state 1-3 being the same is one more thing I like about your design. Here is why.

Already in the logic gates lab designs popped up that had two or two and two states being the same. And they were among the winners and highscorers. Think about it like this - if two states can share the same geometric structure - there are simply less things that can misfold. I think it allows for a more precise switch. Fewer things that can go wrong.

Following that logic, the more states that are able to share structure, the better.

What I particularly like about your design is that it is close to symmetry and especially that the subpuzzle parts are repeats of each other - both are things that would be sins if in excess in static designs - but I have come to regard it as a stamp of quality in switches.


4) Structure repeats

I'm not just seeing symmetry in switch winners or highscorers. I see structure repeats. Like two sub labs fused for a hard design, and having the inputs in the first half of the fusion come in same order as in the second half.

Spvincents design mostly follows the pattern of first rounds best DEC fusion designs. (cBr(B) cAr) By repeat sub parts, just with a different order. (Bcr Acr)
 

http://www.eternagame.org/game/browse/7254821/?filter1_arg1=7384855&filter1_arg2=7384855&fil...

However Spvincents series has the advantage that it has the inputs in the BC part in the same order as the Whbob design that is the best ACDEC design that can work for a fusion and got a highscore (93%) in the first round. While what works for a sub lab may not necessarily be good for a fusion in a hard lab, there still is quite a good shot that it will actually work.
(Edited)
Photo of spvincent

spvincent

  • 48 Posts
  • 9 Reply Likes
An interesting read as was the link to the Logic Challenge results. Your point about fewer switch states being less likely to lead to misfolding is well taken: still I suppose nature, as usual, will be the final arbiter! Looking forward to seeing the Round 2 results: hopefully they'll throw more light on this.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Thx. I like your point of view. I'll go with whatever nature says is right. I'm just taking guessess at the nature of the nature.

My pointers are just that. Pointers. Please keep up guessing what nature is up to.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Omei picked out a promising ABC2INC canditate that has its concentrations switching in the right direction while still switching too weak. I have used this design to try guess what its partner lab may want.

I have drawn an overview of the puzzle. (cARBc) Notice the symmetry and mirroring. (The puzzle itself isn't fully symmetric, but is near symmetric in state 1+3 (Ignoring the static stem).




I did a guess (rcBAcr) for what the ABC2DEC might like based on the INC one. Here I copy the mirroring part. This design doesn't have sublab repeats as the Spvincent design I mention in the post above.

Also the bcdec part does not have its inputs in the optimal order as for a solve in the bcdec sublab, however I still count this worth trying as it may work for the hard puzzle on overall. Just as the design with its concentration that goes in the right direction, doesn't carry full subparts of two smaller sublab designs, but only of one. The two sub part puzzles are sharing reporter. Both doesn't have one.


Help me fix the promising ACB2INC design

This hard INC design Omei picked out, had really high KDON (56 - and it should preferably be under 15). So I have been thinking about how to lower it.

I decided to pull the trick from the Riboswitch on a chip lab where the absolute winner of this lab, used a double aptamer and came out as the design with the highest fold change.

So I have simply doubled and even trippled the reporter binding site, hoping that more reporters will bind in state 4 so it will ease the reporter binding and thus lower KDON. I also did some modifications of the original that I think may improve it.

I will put up some small design series of these types over at the forum post Promising sequences to mutate for this lab round.

You can help me trying to fix the problems with this ABC2INC design.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Difference in length for ON and OFF switches


I noticed that ON switches tends to be needing fewer bases for a solve than OFF switches. ON switches often carry an extra static stem or two. Where OFF switches trends towards using the full space of the sequence length.

These are the labs where I see the trend. 


Here are two partner lab examples

XNOR - ON switch - Long static stem for hiding away bases

http://www.eternagame.org/game/browse/6434648/?filter1_arg1=6501007&filter1_arg2=6501007&fil...

XOR - OFF switch - use of full sequence

http://www.eternagame.org/game/browse/6434627/?filter1_arg1=6471802&filter1_arg2=6471802&fil...

This with ON switches being shorter than OFF switches, in particular happens in puzzles with two or more inputs.

The length pattern in relation to ON/OFF switches, is not universal for all switch labs, eg, some exceptions are the R2 and R3 lab in the A/B labs. They show reversal of the pattern. But I find it interesting that the general pattern is so strong already. Keep an eye out for this. It could help us pick the right solving style to go with the lab type.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
While there is a trend with short solves for ON switches and long solves for OFF switches, it is very well possible (in particular for the smaller puzzles) to solving an ON switch while using the full sequence and often also solving an OFF switch by only using part of the sequence. (Cases of this in BCDEC and ACDEC, ACINC and BCINC)

ACDEC (OFF switch) - close to full sequence use - lab topscorer

No overlap


ACINC (ON switch) - not full use of sequence - lab topscorer

Direct overlap


I fused an ACDEC design (score 100%) with a BCDEC design as for solving the ABRO lab. Both having no overlaps and full sequence use. I ended with a result that looks very much like the round 1 ABRO topscorer


The ABRO (OFF switch) has good distance between its reporter and both the inputs. Whereas the ABRI ones tends to keep the inputs or at least parts of them close to the reporter.

Inspired by this I decided to take a stab again on what the solution to the two hard labs may look like. Here is what I came up with.



The reporter is in between the inputs, just as in the simpler versions of the hard labs, ABRO and ABRI. And the inputs are in the same order.

I still believe in the guess I posted two posts above. I think both ABC2DEC versions are worth a shot. And the ABC2INC drawing is still the design Omei picked out as promising.


Things to watch out for

Here are some patterns I suspect but do not see fully unfolded. But I post them so we can keep eye on if this really is so.

Hypothesis: ON switches will generally like the reporter closer to one or both of the inputs compared to off switches.

Hypothesis: ON switches will favor direct input overlapping, whereas OFF switches will favor partial overlap or non overlap solving style.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Nice, Eli!

The INC pattern is very conducive to taking advantage of coaxial stacks created by oligo binding.


KDON will be lowest if there is no gap between the A, R and B complements.  (As usual, NUPACK won't predict it that way.)

Things are more more complicated in the DEC case, where a hairpin is being used to isolate the reporter complement.  I started to give some advise wrt that pattern, but decided that I didn't have an adequate basis for making any general recommendations.  Have you observed any patterns?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Hi Omei!

On your question on patterns for the Dec case, I am not sure how much advice I can give. The small hairpins that can form inbetween the reporter and input in two of the ON states. (The two little arrows in the ABC2DEC image) can be kind of miniature coaxial stacking stem close to the reporter.)

However I can say what I think will be worth trying out. Already the RO lab is using the full sequence, meaning that if one transfers the topscoring design from the RO lab to the ABC2DEC lab, there will be no room left for placing the C inputs.

A thing that I think will help with trying is to abbreviate the original ABRO highscorer (The two sequences stretches inbetween the inputs and the reporter) This will allow us to attach C inputs at the ends for the hard lab and it may even help us solve the ABRO lab itself.

Abbreviation (seen in state 1)



ABRO design:

http://www.eternagame.org/game/browse/6892307/?filter1_arg1=6975123&filter1_arg2=6975123&fil...
 
I have done a few RO abbreviations.

http://www.eternagame.org/game/browse/7254810/?filter1_arg2=7468135&filter1=Id&filter1_arg1=...
http://www.eternagame.org/game/browse/7254810/?filter1_arg2=7461093&filter1=Id&filter1_arg1=...

I would love to see a ton more ABRO abbreviations and especially some of them transferred to the ABC2DEC lab and C inputs added at the ends. 

I have done a few ABC2DEC ones where I have added a part of the C sequences at ends or inside. (Not stable)

http://www.eternagame.org/game/browse/7254821/?filter1_arg1=7468437&filter1_arg2=7468437&fil...
http://www.eternagame.org/game/browse/7254821/?filter1_arg1=7456670&filter1_arg2=7456670&fil...
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
In the second post in this thread, I mentioned the following:

"I fused an ACDEC design (score 100%) with a BCDEC design as for solving the ABRO lab. Both having no overlaps and full sequence use. I ended with a result that looks very much like the round 1 ABRO topscorer." 

However I got the link to the new puzzle wrong. Here comes the correct one: http://www.eternagame.org/game/browse/7254810/?filter1=Id&filter1_arg2=7456606&filter1_arg1=...
Photo of Brourd

Brourd

  • 437 Posts
  • 79 Reply Likes
Any ETA on the data for the second round of the Open TB puzzles?