OpenTB results

  • 2
  • Article
  • Updated 2 years ago
This is a thread for discussing the analysis of the OpenTB labs and the results

First puzzles:
Let's get started!: http://www.eternagame.org/web/lab/689...
This is it! :http://www.eternagame.org/web/lab/689...

Initial, preliminary data are available for some puzzles in the first round.

Google Spreadsheet: https://docs.google.com/spreadsheets/...
Excel file: https://drive.google.com/file/d/0B_N0...
Photo of johana

johana, Researcher

  • 96 Posts
  • 45 Reply Likes

Posted 3 years ago

  • 2
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Tip for OpenTB Round 4


Use the Glue Tool to create and maintain the puzzle structure you want in your puzzle, while working on making a stable solve. I think doing this will be particular helpful for the two hardest TB puzzles.

Zama found the Progression tutorial that introduce the Glue Tool. Here is a written intro to the Glue Tool.

Here is a lab puzzle example where I found it useful. It is not stable yet.

Astromon made me aware that the puzzle do not remember the structure, so you can't see it when you open the puzzle. It is only remembered in my browser and visible when in target state.

I made 10 base segments from both ends, except for the reporter binding region. (Black highlight rings)

Notice the purple structure icons in the image. (green box)

         

I wish it were possible to conserve the structure also when the puzzle gets put up.


Limiting the length of switching stems

The above puzzle is inspired by some of the Brourd/Nando round 2 puzzles. But structurally it is slightly different.

It deals with direct pairing between inputs and complements and no overhangs between states. Earlier small labs (like the microRNA labs) with inputs perferred overhangs, so I'm not sure this will work. However I am attempting to cash in on the coaxial stacking energy bonus. :)

I have tried make the puzzle bind solely with magnet segments. And made a limit to how long the hairpins stems can get. I try pick the input complementary sequence that I put in the loop area so it doesn't bind with itself.

I made all stems and strands 10 bases long. So each input is set to bind with 10 max bases.

Because hairpins stems that gets too long have a harder time switching. Or don't switch at all.

I am attempting is to make solutions that are less sequence dependent - when it comes to binding with itself, while still taking advantage of the magnet segments and the sequence bias present in the inputs for binding and detatching from the inputs. 

I have made a drawing of what I am attempting.


                
(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
I think this is a very interesting idea, Eli!  It's simple structure seems like just the kind of thing that could produce the nice graded response we are looking for in OpenTB.

But I don't think NUPACK will be of much help in predicting whether the reporter will bind or not.  It will imposes an energy penalty for the reporter binding in state 4, as opposed to the significant boost we observe in the lab.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
@Eli I got to thinking about what the simplest expression of the attraction pattern above would be.  Here's what I came up with for a simple RIRO sensor.

I have never considered submitting an oligo sensor with this pattern, but it seems likely that someone has.  Do you know of examples?  How did the designs do?  Do you have a name for the pattern? It can be viewed as a pair of Bachelor Dilemma attractions, but intertwined in a specific way. 
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
@omei, thats funny. :) I was just considering running a RIRO lab experiment with the isolated pattern. Namely because I don't recall seeing it. This doesn't mean it is not there.

I really like your simplified view. It makes it much more obvious that this is what is happening.

Here is my raw draft. (I=Input, R=Reporter)

   

The pattern can be pulled in 8 different manners. But only the bottom two of them will be intertwined.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
The pattern is of the kind I normally would call intersection style. The inputs bind in a way that are mutural exclusive. The winning Atanas mod A and B RI is of that kind.

Correction to the post above: Only the two top options can be used. The two bottom leave either the input or the reporter hidden in the loop area.

So R' should be swapped with R and A' with A in the drawing.

One more thing. These two bottom options, also fit the pattern of OFF switches liking to have their inputs distanced.

Whereas in the case with the reporter, it likes to be next to the input it is sharing on state with.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I said I didn't recall seeing any direct use of this pattern. However with afterthought, I do recall trying to pull this pattern with intersection and by cutting two inputs in each their half and put them between each other. Not entirely the same. And since I wasn't using the glue tool then, I had trouble making it correctly. Plus a hard time making it stable.

However there is a puzzle type that is doing the same movement while not following the pattern to the letter. Instead of one input versus one input and two inbetween complements, there are two inputs (Input + reporter) versus one input.

It popped up in the two input labs in round 1 in the A/C DEC lab and was made by Rocketdog.

I transferred this design template onto the other 3 sibling labs i Round 3 that had the same inputs. I made puzzle variations in all input order configurations (4) and managed to make some of them work in 3 of 4 labs.

I bet this sublab type can be solved in the double bachelor style in this round and probably will do well. The one input siding with the reporter could be shortened so the two sides of the puzzle are not unequally different in size.
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
Some thoughts on Omei's R'+A+R+A' case:

1) You can replace A by A" (a mutant of A) and R by R" (a mutant of R) such that both A and A" bind with A' and both R and R" bind with R', but A" may have a greater or lesser affinity than A to bind with A', and R" may have a greater or lesser affinity that R to bind with R'. This can help to adjust the relative affinities.

R'+A"+R"+A'

2) You can also reverse the order as long as A' and R' remain on the outside:

A'+R"+A"+R'

3) If you can overlap some of the adjacent regions (such as A" and R") by a few bases, you can possibly improve the exclusivity of response leading to a stronger DEC.

4) Alternatively you could interject a Q, Q' and Q" (such that Q' binds with Q or Q") to further heighten the switch. e.g.:

Q+R'+A"+Q"+R"+Q'+A'

When A binds to A', Q+R' can bind to R"+Q', further sealing off R from binding with R'. When A is not present, and A" binds with A', Q" also binding with Q will tend to hold this closed, further sealing off R" to make R' more available for binding with R.

At least that's what comes to mind. I've been away from this for a while so I could be off.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Jeff, I really like what you been up to.

On point 4 you are correct. I think it can be solved this way.

I managed to solve in this style. I did swap the reporter and input around.

But what I really think you accomplished with this extra part is to allow for 4 different solve styles instead of the only two ways of putting the input and reporter. As when there are 4 parts instead of 6.

Here is a solve: (I got R' and R'' put at the opposite spots in the drawing)

   

Here is the sequence:
UCUCUCUCACAAACCAUCCAUCUGACUAAGUUCUGACACUCUCUCUAGAUGGAAGGUUUGAGAGAGAGAGUCAGAACUUAGUCAA

Here is the lab where I tried it out.

I would love to hear your input on how to pull something in similar style with 3 inputs.

I have been playing around with some switching stems in the hard tb lab.


http://www.eternagame.org/game/browse/8489874/?filter1=Id&filter1_arg2=8516134&filter1_arg1=...

They are probably too short to swap the way I want them to. The idea is that they all match up and if one of their bindings break, I am hoping for a chain reaction that makes the other swap too.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Just for the fun of it. This goes to illustrate that each half of an input, a complement etc. can have different halflives. Or nature.

Here it is the Q's that have become half GA rich and half CU rich.

      

AGAGUCUCACAAACCAUCCAUCUGACUAAGUUCUGACAGAGUCUCUAGAUGGAAGGUUUGAGAGACUCUGUCAGAACUUAGUCAA


Traveling adjacent switching stems

And if the Q's were even longer, they could be made to form a hairpin with themselves, if that were called for in one of the states. That way one can have strands traveling so they fit to make adjacent stems in two different states.

I have managed to halfway pull that in the ABC2INC lab. In simulation.

State 3
     

State 2
     

http://www.eternagame.org/game/browse/8489875/?filter1=Id&filter1_arg2=8518796&filter1_arg1=...
(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Hi Jeff!  It's good to hear from you, and to know that you're still following what's going on in your (relative) absence.

Re the diagram I posted,

the R', A, R and A' labels on the design aren't intended to imply that these are precisely the sequences of the R and A oligos.  The only intended semantic information in this "pattern" is the relationship between the attraction arrows.  To make this work, R and R' only have to be sequences that bind as a whole,   

(This falls in line with a document that Eli and I have worked on (off and on) for 2+ years; see A Pattern Language for Riboswitch Design. This in turn is inspired by Christopher Alexander's A Pattern Language: Towns, Buildings, Construction, which I suspect you are familiar with either directly, or indirectly through the GOF's Design Patterns: Elements of Reusable Object-Oriented Software.)

I did inadvertently obscure this intent by not distinguishing between the attraction pattern itself and its application to designs for the specific class of RIRO puzzles.  For example, we would consider this the same attraction pattern as appears twice in Eli's  initial comment that started this thread.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
@Eli, "intersection style" seems like a good general term.  But this simplest case seems like it should have a more specific name.  Best one that has come to me so far is "entangled pairs".   
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
Omei, Yes I am familiar with the Pattern Language concept. I didn't know that you and Eli were applying it to RNA design. Kudos.

As for R versus R", I'm not surprised you had figured that out, and I still believe that explicitly labeling it as R" can perhaps help make the concept clearer to others.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
@Omei, I really like the term enganglement. This pattern are entangled hairpins.

Actually they reminds me about pseudoknots. I wonder if we could on purpose add such a thing or two in the hard labs. Like the one in the image from your pseudoknot introduction. Actually its structure looks remarkable alike.

Just like there are two extra loop sequences. Kind of like a miniature of Jeff's ARQ pattern.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
@Omei, I recall you talking about pseudoknots in relation to switches.

Now I wonder. Are pseudoknot normally a static structure or a switch one. Can they be both?

If so I also wonder if switch pseudoknots looks different to static pseudoknots?

  • In relation to structure
  • In relation to sequence
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
@Omei, I recall you talking about pseudoknots in relation to switches.

Now I wonder. Are pseudoknot normally a static structure or a switch one. Can they be both?

If so I also wonder if switch pseudoknots looks different to static pseudoknots?

  • In relation to structure
  • In relation to sequence
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Pseudoknot is a term to describe (part of) a secondary structure, just as hairpin loop and multiloop are.  In a switch, they could either be static or a changing part of the switching area.  I think they will be quite useful for designing switches when their thermodynamics are well enough understood to be included in our energy models.  As it is, I think we still create them -- many of the best XOR designs looked to me like they involved pseudoknots.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I also began wondering if two pseudoknots can interact with each other? In other words, tie a double pseudoknot.
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
I would not want to try to create a double pseudo-knot, but it might be possible.

A pseudo-knot can have the form A'+h1+B"+A"+h2+B' where A binds with A' and B binds with B'. Given a design of the form:

A'+R"+A"+R' there is a chance that part of A'+R" could stay unbound and form h1, and part of A"+R' could stay unbound and form h2, letting the rest form a pseudo-knot. This will probably be more likely if h1 and h2 are mostly made up of As and Us, so probably best to end the sequences with Gs and Cs if possible.

If we add Q, Q' and Q" as follows:

Q+R'+A"+Q"+R"+Q'+A'

It might help to prevent this case assuming that the Q's are mostly made of Gs and C's so there will be strong tendency to form either Q|Q' or Q"|Q' and thus avoid the pseudo-knot.
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 123 Reply Likes
There are natural RNAs that are double pseudoknots!
https://en.wikipedia.org/wiki/Hepatitis_delta_virus_ribozyme
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
@jandersonlee Thanks for hanging on to this.  I agree, the choice of notation is important.  I have been using the ' in X' to denote the reverse complement of X. If I keep that, I would prefer not to use ' to also indicate a mutated version.  What do you think about using * to indicate a (possibly) mutated version?  My diagram would become


Note that I've also added a little gap between the design segments, so as not to imply that the pattern demands the subsequences be contiguous.
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 130 Reply Likes
If one adopts a semi-functional notation, allowing for composition of common operations:

rX or r(X) could be the reverse of X (i.e. r('AAG') == 'GAA')
cX or c(X) could be the complement of X (i.e. c('AAG') == 'UUC')
sX or s(X) could be an arbitrary substring of X
mX or m(X) could be mutation of X
X+Y is the catenation of X and Y (i.e. 'AU'+'GC' == 'AUGC')

And by composition:

rcX or rc(X) is r(c(X)) -- the reversed complement of X (i.e. rc('AAG') == 'CUU')
mrcsX id a mutated reverse complement of a substring of X, and so on. 

and by convention we could let A1+A2+...+An = A where A1..An are ordered non-empty fragments of A in case you want to break an oglio into distinct parts.

I suppose X..Y could also stand for X+something+Y where the something is indeterminate and possibly 0 length.

Thus what I originally called X' would actually be msrcX and X" would be msX

While your X* would be msX and your X' would be rcX

So the sequence I defined as:

R'+A"+R"+A and you suggest as R'* A* R* A'*

could also be written as something like:

..msrcR..msA..msR..msrcA..  or ..R'...A"..R"..A.. or ..R'*..A*..R*..A'*..

If you don't like the one letter functions

mut(X) for mutate
sub(x) for substring
rev(X) for reverse
cmp(X) for complement

We could also develop a whoie formal syntax, formal enough that it could be converted to or interpreted by EternaScript code, but I don't know if you want to go that far. Your X' and X* with .. and + may be enough for most cases.
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 123 Reply Likes
i like this discussion thread.

as has been pointed out, one possibility for the future of eterna is to change its interface to involve manipulation of colored beads that represent these differnt domains. There could be an arbitrary number of colors, not just 4 nucleotides, to cover A, B, C, D, E,  ... R, ... and some kind of change in symbol to represent A' [or rc(A) in jandersonlee's notation]

 I'd like to point out that we could even provide an approximate folding engine that simulates the structure of such a pattern given some coarse-grained "energies" for the bead attractions (which might even be tunable by the player). And could even simulate what happens when a small molecule binds, given an appropriate energetic rule set.   And then designs of those patterns could be compiled into actual RNA sequences by eternascript.

I suspect that such a bead interface would even let us design 8-bit adders... its always been a dream of ours to solve that 'feynman challenge', and i recently did a back-of-the-envelope calculation suggesting that we could make such a device with ~2000 nucleotides, and there might even be experimental ways to synthesize lots of such designs for testing.

i don't want to divert this thread further away from openTB, but maybe we could move any 'new game' ideas over to https://getsatisfaction.com/eternagame/topics/eterna-4-what-are-your-big-ideas-dev-chat-followup. i'll seed a discussion there.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Yay, double pseudoknot. Thx, @Rhiju!

Someone, can I get a tripple pseudoknot?
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Intersecting style = larger variation in inputs and complements


The A and B input can be more different in sequence. (In this lab they are not too different in bias) I added some extra colors to the image below to illustrate.



Even the C's part don't need to target the same region in the C input. Doing intersecting style may allow wider variation in the binding sequence picked.

However there are still limits. I strongly suspect that GA and CU rich regions will be preferred for binding, as this is the trend I see for switching elements in need of an effective switch.


Adjusting strength balance

The strength balance of the inputs can be adjusted in three ways.

1) Changing what sequence is targeted for binding to the input
2) Changing the region in the biomarker where the input is cut from
3) Changing the structure of the puzzle

Strength balance or imbalance between the A and B input can be adjusted by a slide of what sequence one cuts from the biomarkers. Or by just sliding what one targets for binding (Since not the full input is bound with). All that needs to change after a change of what part of the input one is binding with for the 10 base input section, is to make sure the complementary sequence in the loop matches whatever is chosen for the input.

Another way to wary binding and the calculation is to adjust the lengths of the C's in relation to the A and B input. All that is needed is to just match the loop that holds the complementary sequence to the same size.

The puzzle mentioned in the above post follows this base distribution pattern:

10 10 10 10 Reporter 10 10 10 10


If the C's (around the reporter) are too strong they can be weakened like this.

11 9 11 9 Reporter 11 9 11 9


Or if it is the A and B input that is bound too easily, the C's can get a longer binding spot. 

9 11 9 11 Reporter 11 9 11 9
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
A while back, Omei started to make a spreadsheet that would allow us to find and recycle TB designs that would likely score well, in another lab than the one they were originally placed in. 

I did recycle some of these designs which were dug up with Omei's spreadsheet. This resulted in me getting a fine bunch of winners in some of the sub labs, thanks to that. 

Omei helped me with making the continuation for the last category of labs that wasn't covered. Here is the full collection. 

Digging out future TB winners from failed designs

The two hardest labs are not shown on their own as these you can get, just by sorting after global fold change.

If you recycle, remember to filter so you don't take designs with way too high fold change error rate. Try something like a max of 1.25.


Promising design for ABC2INC

While these spreadsheets were in the making, I noticed that there were a good ABC2INC candidate that I had missed out on. Because I had only sorted for global fold change in the hard labs, not while also looking at the sublabs. Omei and I discussed this design. Since we have a new round of TB now, I wish to bring it up as for us to use this knowledge.

NB, the design in question is a round 1 design with different inputs, but if we can ape the structure, I think it will be really interesting.

1) Copy in the design from round 1 to the open ABC2INC lab
2) Native mod may be able to display the overall structure
3) You can use the glue tool to force hold the structure
4) Change the inputs to fit round 4
5) Change the region that pair with the inputs, to fit the updated inputs

I have made an early attempt. It is not stable.


Note also that Round 1 and 3 often has input reversal compared to round 2. Meaning if B comes before A in round 1 and 3 (can't remember which way now) then A tends to come before B in round 2.


Discussion between Omei and I

Eli: While there were no general surprise of the GF of the non hard labs, there was one single surprise. There did turn out to be one additional design that scored better GF than the one of mine you picked out for ABC2INC. And its a failed RO design. 

This one: http://www.eternagame.org/game/solution/6892307/7053820/copyandview/ It got a GF of 2.19, which is better than my 2.03 one. And it has a far lower KDON. Wish I knew what the switch graph would look like. Its a round 1 design so it doesn't have one. Its similar to my RI designs that did well but was below in potential compared to Atanas design style. (edited)



It doesn't even have any landing spots for C inputs. It does the calculation right, with just the A and B input


----- Thursday, May 4th -----
omei [12:35 AM] 
Hi Eli!  This is indeed an interesting design.  I'm not sure why you think the switch graph is missing.  The URL is https://s3.amazonaws.com/eterna/labs/histograms_R104/7053820.png (989 kB)
and the data browser displays it.

This is not a typical switch graph for Open TB.  Note that that many of the FMAX values have values greater than 1.  This implies that there is more going on than NUPACK is picking up on.  Nine times out of 10, when this happens with a design that has an adequate cluster count (which this does), I find unpredicted coaxial stacking to be involved.

Here's NUPACK's prediction of the no-ligand folding.  Looks quite reasonable, but doesn't account for a FMAX of 1.56.

              


omei [12:48 AM] 
 
                

But now consider this possible folding.  Only 5 of the 10 reporter bases are bound, but it is being reinforced by the long hairpin.  And it is not competing with the other reporter binding site.  In fact, with only 2 bases separating the helices, there might be a little bit of additional boost when a  reporter oligo binds to both sites at the same time.

I had also prepared some target structures showing how C could be quite reasonable be bound by being reinforced by a contiguous stack.  Unfortunately, we had an (uncommon) power outage, and the target structures were lost before I could take screen shots.  But my impression is that this is actually a very complicated design to understand, because under many conditions, it has many possible foldings that are probably energetically similar, and thus the experimental data reflects a mixture of foldings.

I can't edit the caption above, but when I said "with only 2 bases separating the helices" I meant only 2 bases separate the two (full/partial) reporter complement segments.


eli [7:36 AM] 
Hi Omei! I'm sorry about the power outage. Sucks. 

Oh, on the missing switch graph, I meant your slick 3d view. I really like that one. :)

However I find what you highlighted very interesting. There is almost a double reporter binding site at two spots. This may just be another way of making both ON and OFF state perfectly happy. It is just the other route around compared to your winning mod Atanas RI design. He split the inputs in two to leave them two different ways to bind up. Here it is just the reporter landing site that is split in two. This may be the easier route, when the puzzle gets harder. 

I don't think I have heard Fmax connected with extensive coaxial stacking before. I find your observation very interesting. Feel free to spill in the forum when you feel ready. I think this is worth looking out for and could help us understand the data better.

By the way, I put in the sequence of the RO design into the ABC2INC design and it turns out that there is a binding site for 1 C input. So now I wonder if this puzzle really do the same calculation. I mean, it is A*B/C and not A*B/C2.

But this C landing spot also kind of explains why the puzzle work at all. This leaves the OFF states (1-3) some room to get distance to the reporter, given that OFF states are generally not fond of having inputs close to the reporter.  

Also both ends of the puzzle seems involved in covering up sequence inside the design at times.

RO moonlighting as ABC2INC




omei [9:09 PM] 
There's a landing site on the 5' end, too.


eli [9:10 PM] 
Ok, I see, but it seems rather short.


omei [9:10 PM] 
Line up the four exposed A's with the 4 U's on  C, and then extend it.  It will break up that loose hairpin.


eli [9:11 PM] 
Ah, good point. The double C's can pair directly with G's in the C input

Ok, so doing the right calculation

And I think it may have a higher inbuilt potential than my design as it binds the reporter at so low KD. Me pairing the A and B complementary sites with each other helps hiding the reporter, but it also makes it harder for A and B to reach a concentration big enough to attach in state 4. As these two are low concentration.


omei [9:13 PM] 
...  and it gets reinforced by the coaxial stack formed when A binds.


eli [9:17 PM] 
I am not sure I understand the last bit

Unless perhaps in state 4 when both A and B binds, they are close to coaxial with the reporter.


omei [9:18 PM] 
When both A and C bind on the 5' end, the stacks they form have no unpaired bases between them, and this they become essentially one long stack.


eli [9:19 PM] 
Ah


omei [9:20 PM] 
As a first approximation, they have a combined energy which is the same as though there was a continuous backbone connecting the A and C.


eli [9:22 PM] 
This is similar to what happens in my highscorer. The first C input is close before the A.


omei [9:23 PM] 
How close?


eli [9:23 PM] 
One base distance

http://www.eternagame.org/game/solution/6892317/7001278/copyandview/

Can be seen in state 4


omei [9:25 PM] 
Yes.  As a rough estimate, the coaxial stacking bonus where there is one unpaired base is about a quarter of the boost when there is no unpaired bases.


eli [9:25 PM] 
Thats a nice rule of thumb


omei [9:26 PM] 
To be honest, I made it up just now.  But I think it accurately reflects the data I have seen.


eli [9:28 PM] 
Hehe, cool

I suspect the RO design works, because it allows the reporter to be much closer to both inputs as you have wanted. (State 4) But that it still can be made into decent offstates, because either the C inputs tip the balance away from B binding. (State 1) State 2 has the reporter away from one of the inputs. State 3 the C concentration takes care of burrying the B input.


omei [9:31 PM] 
I thought you had said that in the lab it failed as an OFF switch.


eli [9:31 PM] 
So both ON (Inputs next to reporter) and OFF state (Inputs distanced to the reporter) can be made happy. And don't have to compete and do a compromise as in mine

Yup. Its a crappy RO design


omei [9:32 PM] 
That's what I would expect.  It only looks good in Eterna because NUPACK gets coaxial stacking all wrong.


eli [9:32 PM] 
It has reporter inbetween two inputs which makes for a perfect ON design/ON state. OFF state are not happy about that configuration.

But the placements of the C inputs, helps tip the balance so the A and B inputs can be kicked off or bind less well, helping the advancing the OFF states. Not strong off states, but still


omei [9:34 PM] 
I understand now.  You're referring to the OFF state when tested with C concentrations.


eli [9:35 PM] 
Yes. One of the big challenges for making good hard lab designs is how to deal with making the OFF states differ from the ON states, as they don't like the same.

Atanas design did that brilliantly for the RI lab, but it is a complicated way. This RO design gives me hope of finding a simpler way, that will also work for the hard labs

I mean, here we can tip the A and B input away from the reporter (for OFF states) with concentration of C. Despite both A and B being close to the reporter. And when Both B and A are present, this tip the balance back to them being being next to the reporter for ON.

Ok technically this only happens for the B input.

I mean it overlaps with C. A do not.

But B won't go full on as long as A is not around, so same effect.


omei [9:43 PM] 
One thing I have discovered is that overlapping inputs does not necessarily mean they are mutually exclusive.

In the right conditions, they can actually reinforce each other's bindings instead of kicking the other out.


eli [9:44 PM] 
Hehe

I wonder, can the tail from one input pair up with the tail of another - if there are complementarity


omei [9:45 PM] 
I can't think of any reason they couldn't.


eli [9:46 PM] 
Wicked!


omei [9:46 PM] 
That would be a second mechanism, not the one I was thinking of.


eli [9:46 PM] 
How much input landing sites overlap also matters for the switching ability. Too long a stretch and they are not switching well

:)

What is the one you are thinking off?


omei [9:48 PM] 
I posted an example in the forum some time ago; let me check.


eli [9:49 PM] 
sure



omei [9:58 PM] 
CUAAGUAGG
GAUUCAUCCUAGUCA
                 AGGAUCAGU

Consider the above situation where the middle line is is out switch design and the top and bottom are oligos. (edited)

On the surface it looks like they would be competitive

But in fact, the lowest energy would be for both of them  to bind at the same time, forming one longer stack 15 bases long.


eli [10:01 PM] 
Because it is a real short overlap between them, right?

But wouldn't the two GG sections repeal each other?

So is it always more energetically favorable to have stacks forming comparable to having more loose bases?


omei [10:05 PM] 
Only one of the either oligo could bind to the design at a time.  But the fact that both oligos are extended well past the section in "competition" means that they both stick around even when the other (temporarily) has control over the disputed segment.


eli [10:06 PM] 
Gelatinous slow down of switching...


omei [10:08 PM] 
I've constructed this case to be simple.  In this case, the choices nature has is for 1) one or the other to bind (but not both) and end up with an 8 or 9 base stack, or 2) both bind and end up with a 15-base stack.  The 15 base stack has a much lower energy, so it wins.

The fact that the 3 contested bases will probably be shifting from one camp to the other over time isn't really a factor in the total energy.


eli [10:12 PM] 
What you says make sense


omei [10:14 PM] 
I believe this is actually the largest single factor in the large number of designs on OpenTB 1 that switched the "wrong" way, i.e. had fold changes < 1.


eli [10:15 PM] 
Ah, like socalled shared landing spots were shared parking spots at each side.

And it would good make sense it happens as our biomarkers are rather long

This doesn't happen in the logic gate labs, as the inputs were not overlapping

So even while they were long, they were not in direct competion

inputs - complentary binding sites


omei [10:19 PM] 
Yes.  I'm looking for a document ...

omei [10:24 PM] 
uploaded and commented on this image:


Here's an example of the overlap between B and C in Rounds 1 and 3.

The --- indicate that an appropriate choice of base in the design will bind to either oligo.


eli [10:25 PM] 
Looks great

visually
 
So the first bit of B that is not overlapping has some rather strong G bases. Not happy to let go.

CCs too

So this bit will be likely to stick around even if C should have luck attaching


omei [10:27 PM] 
uploaded and commented on this image:


... and here's one for A and B.

A and B is even more obvious; it is a more extreme case of my made-up example above.


eli [10:30 PM] 
I'm a bit in doubt of the UUCC and CCUU region. I mean they won't both attach to AAGG or GGAA


omei [10:31 PM] 
(I didn't realize this was going to be a problem when Michelle proposed the oligos.  It was only after looking into why there were so many designs folding the wrong way that I realized this was a major factor that I hadn't given any thought to previously.)

The design sequence GUUGUGGGG can bind to either oligo with no mismatches.


eli [10:33 PM] 
Ah :)

Now you mention it. As in both your examples, I suspect the problem will be bigger if there are two strong bases just before or after where the overlaps are made to happen. This would leave less reason for the input to leave


omei [10:34 PM] 
So we could end up with a stack of 26 (if I counted right) bases when both oligos bind.


eli [10:35 PM] 
Also I still suspect that input order matters for when overlapping is done. I expect that inputs won't zipper equally easy off, just depending on if zippering from 3' or 5' end of the design sequence.


omei [10:36 PM] 
I have no feeling for that.


eli [10:36 PM] 
I mean beside the flourescent tag effect.

I can't give any proof. But I'm looking out for an eventual effect being there. I expect it could be there.

The A input in your example will have to zipper up from the 5' end of the design sequence (its 3') where the B input will have to zipper on from the 3' side of the sequence (its 5' end)

I don't think they are equally easy - given that input strength had no effect or were equal


omei [10:39 PM] 
Anyway, I think that the fact that the original oligos have this pattern of sharing R/Y sequences at opposite ends was bad luck, but had a large effect on the overall results.

When you say zipper in this context, are you referring to one of the oligos displacing the other?


eli [10:41 PM] 
Yes

I'm imaginine the one zipping on at one end and then just like a zipper working its way to displace the other

And since RNA is chiral

I don't expect each way to be equally easy


omei [10:43 PM] 
That certainly seems like the obvious kinetic pathway.  But it should happen so quickly that I can't see how it would relevant to the resulting equilibrium.

I.e. how it would show up in the data we get.


eli [10:44 PM] 
I don't know how to show it yet as there are many other variables in play such as difference in input strength etc.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
What can we learn from sibling designs?


Gerry started a lab design analysis thread. Also a special thanks to him for the fine initiative. I suspect this will be extremely helpful for the future.

As a part of that he volontered to pull out design pairs from our TB round 2 based on similarity and how different they were in score. I have been looking at one of his latest spreadsheets, the one on the DEC lab and global fold (GF) change.

                   


Good and bad spots for GU pairings

Here is something I think we can use for making better designs.

Gu's are bad when created between the reporter and its complement.

While I have looked only at a fraction of the designs, a pattern is already emerging. It stands much more out in the DEC spreadsheet with GF than the one for score, while the trend is also there.

Mutations that leads to a GU forming between the reporter and the complement is mostly bad. However there is an exception. If that GU forming between the reporter and its complement, is also helping form a GU or mismatch inside a longer switching stem in another state.


Examples with unmutated reporter binding or with GU

Red case

Gu mutation to reporter complement unhelpful (case 1)

Good unmutated reporter complement

             

http://www.eternagame.org/game/solution/7113332/7243594/copyview/


Bad mutated reporter complement

             

http://www.eternagame.org/game/solution/7113332/7243629/copyview/


Green case

Gu mutation to reporter complement helpful as it destabilize long switching stem in another state. (case 8)

Long stems really dislike switching and breaking them up will go a long way to help switching along.


GU mutation to reporter complement partially helpful

             

http://www.eternagame.org/game/solution/7113332/7235556/copyview/


No Gu mutation, less helpful as a long stem in another state gets too stable to switch happily.

            

http://www.eternagame.org/game/solution/7113332/7235554/copyview/

But to get the helpful effect from the GU in these green cases, takes a toll on the reporter binding.



Use your GU's smarter


There however is a way to get this effect without weaking the bind to the reporter - or to any other input for that matter.

Don't mutate your reporter complement. Make GU in the long switching stems without touching the reporter binding site.

Unmutated reporter

               


Get the best of both worlds - mutate your GU's here


               

Avoid putting them in other input complements as well.

Instead of making the weakening bind between the reporter and its complement, make that weakening bind at the other side. If that complement binds up to something else and this is in a long stem. Make an A in that reporter/input complements complement, a G.

And voila you have a free GU will all its benefit and without the cost on the reporter binding.


Afterthought

Just as the reporter complement dislikes mismatches or GU's forming against it, I think the same will be the case to some degree for input complements. However as they grow in length they do need an occasional mismatch or GU forming against them.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I wish to confess I committed just the sin that Atanas pointed out with his recent post on clusters of designs.

I was aware of that the designs that I dug out from Gerry's spreadsheet on the ABC2DEC lab with Global Fold change were originating mainly from the Nando/Brourd designs of the entangled kind.

What I say above about GU's and mismatches against the reporter and inputs seems to go for this type of designs to an extreme degree.

Much more than it does for the open ended design type of AndrewKae. These accept not only GU mutations against the reporter, much shorter reporter, even reporter mismatches. And the same goes for the inputs.

There is one difference more to these two design types. The open ended ones have the reporter at sequence ends where it is easier for the reporter to access its complement. Whereas the entangled designs have the reporter burried in the middle.

So it may be that different design types do allow different amount of GU's, mismatches and length of the reporter complement and the input complements. But I think there is even a limit for the open ended designs. It is just a bit larger. Still worth looking out for. So I'm not regretting what I said in the above post. Just adjusting the precision of it.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
A better way to select promising designs for OpenTB Round 4?

In selecting the winning scores for Round 2, we used the global fold change, as defined by Johan, as the measure of the overall "success" of a design.  But for the purpose of looking for promising designs to improve for Round 4, I think a different criteria might be more useful.

Explaining the global fold change is best demonstrated using the 3D section of the switch graph.  Here's the one for Andrew's winning design.


Looking at the bottom "Target", there is an almost-horizontal black line in the middle of the chart.  This actually represents a two-dimensional plain in the "3D" space, but the viewing point lies on the plane itself, so we can't see the top or the bottom of the plane.

The numbered circles represent KD values for each of the 19 conditions that Johan created to test our designs.  In the ideal solution of the A*B/C^2 DEC puzzle, all the points above the central plain should have lower KDs (i.e. be more yellow) than all the conditions below the line (i.e. be more blue.)

However, the 19 conditions were chosen so that together, they fairly evaluated all of the puzzles, from simple sensors to full A*B/C^2 puzzles, and they are not all equally relevant to the full A*B/C^2.  puzzles.  In particular, only conditions 6-12 were selected specifically to target the evaluation of the full A*B/C^2 puzzles. For these seven conditions, oligos A, B and C were all present, in ratios that represented plausible levels in human blood. I have marked these conditions with a red ellipse, and will refer to them as the central conditions.

All the other conditions had one or more of the oligos completely missing, i.e. were out of the range of physiological conditions.  There was discussion about whether or not these conditions should be included in the evaluation of the full puzzles, but I think I won't go into those details here.  The final conclusion was to not include conditions 17-19 (hence they are grey in the bottom chart) but include 1-7 and 13-16.  These became the definition of the global fold change.  That is, two KD values would be chosen -- the highest (least yellow) of the yellow dots and the lowest (least blue) of the blues dots, and the ratio of those is the global gold change.  The situation is different, but completely analogous for the INC version.

But I have also now calculated the "central fold change", i.e. the same calculation except for being based only on the measurements in the red ellipse.  They are available as the fusion table Eterna R105 (Open TB Round 2) results, with Central Fold Change.  If you prefer a spreadsheet format, just download the fusion table as a CSV file and load it into your favorite spreadsheet.  if you like the fusion table format, I suggest you immediately make your own copy and work with it.  Otherwise, Goole doesn't save any of your settings, like filter conditions, new tab views, etc.

I have more to say about what I see in these results, but that will have to be in a subsequent post.

Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 129 Reply Likes
So is the objective to have a higher central fold change? (I notice most of my mods, even the better scoring ones, had CFC<FC.)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
@omei, this is extremely  valuable and helpful.

Ok, so this is what I hear you say.

Global Fold change should only be calculated from the concentrations that are directly relevant to the two puzzles doing the full tuberculosis calculation.

Plus that you call for a new definition and calculation of Global Fold change for the future labs.

I concour.

Oh, and I like it. Really nice looking Central Fold changes in that new spreadsheet. :)

Question: What do the new columns with Max, min and top and bottom central mean?
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Ok, I figured what the max and min columns are. It is just like calculation of Fold  change and Global fold change. Pick the worst number for the off state versus the worst number for the on state.

Here MinBottomCentral/MaxTopCentral = Central fold change

Example with the top scorer in the new sheet:

23.05/1.97 = 11.7
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 129 Reply Likes
By my estimation there are about 16 relatively good [A}*[B]/[C]_DEC designs where CFC_OFF>=FC. Most are by AndrewKae, with one each by spvincent, ElNando888 and Malcolm. I wonder what is different about them?

  • DesignID Design Player 
  •   7230841 A*B/C*C Dec Mod20 spvincent 
  •   7233510 AK2.4 [A]x[B]over[C]_ DEC AndrewKae 
  •   7233512 AK2.5 [A]x[B]over[C]_ DEC AndrewKae 
  •   7235910 DMSSD DEC S#3 42 ElNando888 
  •   7230690 AK1.6 [A]x[B]over[C]_ DEC AndrewKae 
  •   7233508 AK2.3 [A]x[B]over[C]_ DEC AndrewKae 
  •   7237657 A*B/C*C-DEC#36 Malcolm 
  •   7233501 AK2.2 [A]x[B]over[C]_ DEC AndrewKae 
  •   7230668 AK1.1 [A]x[B]over[C]_ DEC AndrewKae 
  •   7230679 AK1.2 [A]x[B]over[C]_ DEC AndrewKae 
  •   7233493 AK2 [A]x[B]over[C]_ DEC AndrewKae 
  •   7230694 AK1.7 [A]x[B]over[C]_ DEC AndrewKae 
  •   7233495 AK2.1 [A]x[B]over[C]_ DEC AndrewKae 
  •   7233524 AK2.6 [A]x[B]over[C]_ DEC AndrewKae 
  •   7230655 AK1 [A]x[B]over[C]_ DEC AndrewKae 
  •   7230685 AK1.5 [A]x[B]over[C]_ DEC AndrewKae
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
@Jeff and Eli: I wouldn't go so far as to say that the Central Fold change should replace the Global Fold change.  It is more a question of "How much weight do you assign to various pieces of evidence?"  The Central Fold Change gives no weight to the measurements that don't contain all three oligos, while the Global Fold Change gives them just as much weight as the measurements where all three are present.  Two extremes.  

For Round 4, the plan is to test on at least a few actual patient blood samples, where all three inputs will be present.  This is a primary motivation for suggesting that now we, as players, look at the Central Fold Change as well.

@Eli: Yes, you understand the calculation correctly.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
@jandersonlee I'm not sure whether this is what you mean by "what is different about them?"  But the first thing I do for a particular design is to look at the right half of the switch graphs.  Here's the one for the first item on your list.

Looking first at the text lines, I've added some annotations.  I've covered up the conditions that aren't considered in either measure.  The middle black line divides the upper and lower half of the conditions, i.e. separates the conditions that the global fold change is based on  The two lighter gray lines bound the central fold change conditions.  So if you want to pick out the one or two conditions that made the global fold change smaller than the central fold change, look for the largest KD above the middle line and the smallest KD below the middle line.  These are the two conditions that determine the global fold change.  If either or both of these fall outside the central fold change lines, they are the (primary) reasons for the difference between global and central fold changes. 

In the above example, the largest of the top half is 4.6, for condition 2.  This is outside the central fold change region, so condition 2 had the largest effect on making the denominator of the global fold ratio larger than that for the central fold change.  For those below the line, the smallest KD value is 12, for condition 9.  This is inside the central fold change area, so there is no difference in the numerator of the two fold changes.

If you are more visually inclined,  you might rather pull the same information from the graphs.  Looking at the bottom graph, condition 2 is clearly the least yellow. It is on one of the "background walls", so it is not part of the central fold change.  Picking out points from the bottom half is a little harder just because you have to ignore points 17-19, i.e. the ones that lie on the intersection between the "walls" and the "floor". In this case, it is visually clear that none of the conditions on the central "floor" is less blue than the central  conditions 13-16, visually verifying that the extra conditions used in the global fold change calculation made no change to the OpenTB ratio.
Photo of jandersonlee

jandersonlee

  • 555 Posts
  • 129 Reply Likes
By "what's different about them" I mean, is there something unusual in the ways they are designed (e.g. pattern-wise) or constructed (e.g more GU, less GU, no GU in R', etc.). I was kind of hoping that Eli would "take the bait" as he's much better at figuring out those sorts of things than I am. :^)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Biting... :)

I have looked at the designs Jeff pointed out as having bigger or equal size central fold change to fold change. (CFC_OFF>=FC)

General sum up: Biggest design group by AndrewKae with overall best central fold change (4 - 11.7) and global fold change (1.94 - 4.85) has input order rcABc - the c's both overlap each part of input A and part of input B.


Design groups

There are three design groups that stands out. 

Two groups that has an open ended design type and a third group of an entangled kind of a design. The later is of a very different nature than the first two. 

Type 1: AndrewKae  Openended + Input lane sharing           (14 designs)
Type 2: Malcolm       Openended + Input lane sharing           (1 design)
Type 3: EINando      Entangled - No input lane sharing         (1 design)


Input order


Type 1: rcABc   
Type 2: cBAcr 
Type 3: BcrcA 


Designs groups ordered (Greatest to least)

Best central fold change range

Type 1:  4 - 11.7
Type 2:  5.4
Type 3:  4.9

Best Global fold change

Type 1: GF range  1.94 - 4.85
Type 2: GF range  1.52
Type 3: GF range  1.62


Drawings of the design types





Dataoverview 

  • DesignID  Design                                     Player             Type
  •   7230841 A*B/C*C Dec Mod20               spvincent            1
  •   7233510 AK2.4 [A]x[B]over[C]_ DEC    AndrewKae         1
  •   7233512 AK2.5 [A]x[B]over[C]_ DEC    AndrewKae         1
  •   7235910 DMSSD DEC S#3 42              ElNando888       3
  •   7230690 AK1.6 [A]x[B]over[C]_ DEC    AndrewKae         1
  •   7233508 AK2.3 [A]x[B]over[C]_ DEC    AndrewKae         1 
  •   7237657 A*B/C*C-DEC#36                   Malcolm              2
  •   7233501 AK2.2 [A]x[B]over[C]_ DEC    AndrewKae         1 
  •   7230668 AK1.1 [A]x[B]over[C]_ DEC    AndrewKae         1
  •   7230679 AK1.2 [A]x[B]over[C]_ DEC   AndrewKae          1
  •   7233493 AK2 [A]x[B]over[C]_ DEC      AndrewKae          1
  •   7230694 AK1.7 [A]x[B]over[C]_ DEC   AndrewKae          1 
  •   7233495 AK2.1 [A]x[B]over[C]_ DEC   AndrewKae          1
  •   7233524 AK2.6 [A]x[B]over[C]_ DEC   AndrewKae          1 
  •   7230655 AK1 [A]x[B]over[C]_ DEC      AndrewKae          1
  •   7230685 AK1.5 [A]x[B]over[C]_ DEC   AndrewKae          1

Sum up and potential improvement

The main and best part of the designs are the type 1 group by AndrewKae.

All of these designs have a higher KDON (worse) for the ON states for one particular concentration. Concentration 2 always gets the highest KDON. It isn't central to the central fold change, but it is one of the bits of the global fold change we can improve. 

I think I can explain what goes on and what is needed to get a better score. 


What is happening


    

Both A and B are partly overlapped by C inputs. So that higher concentrations of C inputs can kick out A and B. However their overlaps are not equal in size. 

A is half overlapped by C. 

Meaning that both A and C are in direct competition with each other as kind of equals. 


Concentration 2 -  A and C at 100 nm (nanomolar)

For concentration 2 their concentration is equal.

So A and C are in direct competition for a bind and fighting each other. 

Hence they both have a harder time binding at once. Hence concentration has to be higher for registrering that both A and C has bound. As they only each have half a lane for binding. 

Also there is the reporter binding at the side of A and not the side of B. That is also making things different. 


Concentration 3 - B and C at 100 nm. 


Whereas C only overlaps something like 1/4-1/3 of the B input. Giving both C and B plenty of space for binding when they are both present at equal concentration. 


Worst KD for ON and OFF states

Concentration view





3D view

                

What needs to change


To make a lower KDon for concentration 2, A needs to be only slightly overlapped by input C. Something like 4-6 bases. 

This too should help with improving the worst OFF state. Concentration 9 and 11 gets the lowest KD for the OFF states. 

In these states input A and C are in competition with each other. 
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Jeff also asked what was the difference between the different design groups. I go into that in this post.
Photo of whbob

whbob

  • 193 Posts
  • 58 Reply Likes
@omei , How are the global and central Fold Change ON values calculated? They are very close to zero in the examples that I have seen.  Does ON mean concentration numbers 1-6? 
Photo of whbob

whbob

  • 193 Posts
  • 58 Reply Likes
@omei , How are the global and central Fold Change ON values calculated? They are very close to zero in the examples that I have seen.  Does ON mean concentration numbers 1-6? 
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
As far as I know, AndrewKae's 16 or so designs appear to all be based on a single sequence template. Do you happen to know which mutations caused increases and decreases in fold change? Also, how do other designs with the rcABc template do in terms of their score? I'm rather curious to see if one of the templates that involve overlapping inputs results in a higher average fold change.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Brourd was curious about what mutation points in AndrewKae's good ABC2DEC designs that were causing better fold changes. 

I took a look at the design series 1 and 2 and bring back answers. 


Method

  • I picked AndrewKae's AK1 design and considered it the origin. Then I pulled a sort in the classic Eterna interface. (Lab link) to get the designs ordered after closeness. 
  • I copied the relevant designs from Omei's Central fold change spreadsheet and made my own spreadsheets and kept only the data relevant to me. 

AndrewKae series 1 and 2 design sum up

Only two of the mutants do not do as well as the origin, if looking at central fold change. 


Link to spreadsheet


Mutation types

The design in the series has been tested with a battery of a few mutations at specific places. Many of the mutations being the same. A few of them have a particular good effect. But for different reasons. I have tried sort them after what I think is their order of importance. 

Here are some types of mutations that affect fold change, global fold change and central fold change. I have ordered them after suspected impact


1) Enhancing the reporter signal

A G base placed right after the reporter complement have an enhancing effect. 

11 out of 15 design has this mutation and they all do better than the unmutated origin design. 

Sorted by the design AK1
    

This after G reporter enhancement is an effect we have witnessed in earlier labs also. 

Search for this section in the post: 
Reporter binding is influenced by base sequence after the reporter

Now the G after the reporter in this example is also placed at the end of the sequence which in itself seem to have an effect on the fold change. But the interesting thing about the G's after the reporter in AndrewKae's designs is that they are not. 


2) Binding better to the input


Mutation C65, U66, A75 to the C complement are helping the C input bind better. 

C65 makes a GU between the C input and its complement become a GC. 


3) End bits mutation

9 out of 15 designs have the A1 to U1 mutation and 8 of these designs do better than the original design without it. 

We have seen in previous labs that exactly the first and last base in the design could have a huge effect on the design score and fold change. Particularly the UU kind that the main part of AndrewKae's designs possess.  

Salish’s end bit discovery put in perspective

This may make sense if viewed in the light of what Omei has mentioned about RNA designs being able to coaxial stack with the outside scaffold of the design at both ends. And as such also the base next to the scaffold can have an effect. 


4) Mismatch to the input

The mutations A67 and G71 are C input mismatches. 

The ratio of mutations to improve C input bind outnumber the mutations to create mismatches to the C input. 

Generally these mismatches, replaced another mismatch that were made a bind instead. So the number of mismatches against the input stayed constant. 


5) Tail mutations

These could either make a tail magnet more or less stable. A few of the cases I think were helping to discourage the pseudo reporter binding site that is present at the 3' end of the sequence. A small part of the sequence for the reporter binding is there. But it being there in more full will discourage a tail magnet, which seemingly is having a positive effect for now. 


Mutation highlights



Blue - endbit mutation
Red - reporter G enhancement
Purple - stronger bind to input
Orange - mismatch to input
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I wish to highlight that Cynwulf has noticed a couple of glitches in relation to the OpenTB puzzles. They are mentioned in the comment section for one of the TB labs.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Andrew’s Key: Reporter turnoff proximity matters


The closeness of the reporter to its turnoff sequence matters for strong switchability.


Far apart - less effective. Closer - boom time.


Also it seems to matter how long this switching hairpin is. If it gets too long it seems to lower the fold change. This is really the whole old story all over again. It is harder to make a long stem switch than a shorter one.

Knowing that a short range turnoff sequence if hidden nearby the reporter can can lead to a strong turnoff - and turnon - could be used to improve our lab scores.  



AndrewKae’s puzzle demonstration


I have been watching AndrewKae’s OpenTB presentation.


I took note of the smaller design he demonstrated, with the switching hairpin.


Reporter and input with highlighted complementary parts. Separated by only 4 weaker bases - that will become loop in the other state. (Images shot from his presentation). 


Input and reporter bound 


Actually this design has two such turnoffs. As the small hairpin in the beginning of the sequence is a tail magnet targeting a bit in the input - also a pairing close in sequence and space.


Input and reporter turned off - by each other


A nice portion of the designs with the all time best fold change over our previous 3 OpenTB rounds in the RIRI sensor labs follows a similar pattern.


Andrew is using the exact same technique for reporter turnoff in his round 2 ABC2DEC puzzles.



The switch pattern


The reporter turnoff is hidden as a nearby complementary sequence in the nextdoor input complement. When the reporter and inputs needs to be turned off, part of the reporter and a short stretch of the input creates a short hairpin stem between them.  



Illustration of the pattern

              



What problem does this reporter turnoff pattern solve?


Turning off the reporter in a hairpin stem like way is the perfect way to create a compromise between what an OFF state and an OFF state wants as in certain puzzles they want something different.


  • ON state prefer to have the input and the reporter coaxial stacked.

  • OFF state that have the reporter and the same input next to it and needs to have both of them off, has a problem as it has what the ON state prefer.

Having the reporter turnoff buried in the nearby input - allows for a swift and strong turnoff. Having the reporter close to or (coaxial) next to the reporter allows for a strong and swift turn on.


This will be of particular use the reporter and input both needs to be ON in one state and OFF another.


Background post:

About compromises between ON and OFF states


Where can this reporter turnoff pattern be of use?


This switching hairpin for reporter turnoff tends to happen more in OFF switches. Its a way to use a nearby input that isn't needed around - for turnoff - when the reporter needs to gets turned off. 


However it isn’t solely an ON and OFF switch question. As the pattern is strong in the RIRI sensors. ON puzzles. They are of the kind reporter in, input in. 


The pattern happens particularly in puzzles where an input and the reporter both needs to be on in one state and then both off in another state. Like the RIRI sensors, plus if there are more OFF states than ON states. Like the hard dec puzzle.


Perspective


If the reporter complement and its input complement are too far apart, they will be less effective. 


This may also explain why real strong magnet segments tends to turn up in long range turnoffs. Like tail magnets. The further apart, the stronger bases are needed to do the pull.


Different switch puzzle types depends on different reporter turnoff patterns. The more entangled pattern types depends on long range turnoff of the reporter. Where the open ended design type like AndrewKae’s puzzles depend on short range turnoff.


However the reporter could get modified to be better suited for a long range turnoff. Or rather as we have already seen with the MS2 - it has strong magnet segments in itself - that allows for longer range turn offs. 


Related subjects


The structure of a turned off sequence

Triloops for easy to break stems

Tail magnets: Long range turnoff






(Edited)
Photo of cynwulf28

cynwulf28

  • 83 Posts
  • 26 Reply Likes
*If someone has already addressed this query elsewhere, please let me know* 

   I have been thinking about the TB labs and it occurred to me that if we were to classify designs (for any given sub-Lab) based on the overall schematic layout of the elements (i.e., reporter, oligo-A, oligo-B, etc.) of that lab, that we would find that there are only a certain number of possible arrangements which could ever be employed (similar to the number of possible plots for a story https://en.wikipedia.org/wiki/The_Thirty-Six_Dramatic_Situations ). <br/>
  My thought here is that though finite, there are still a great many possible arrangements for any given sub-lab which may be used... and that there are arrangements which have likely never been tested. <br/>
  Not all of the possible arrangements, which would work in principle, would be expected to work in lab, but I still wonder if we aren't potentially missing something vital in likely not having tested many of these options. Doing some very rough estimating, I got an upper bound of ~343 possible arrangements of elements for the each of the [A]/[C], [B]/[C], AND A*B labs, and ~4096 possible arrangements for each of the [A]*[B]/[C]^2 labs.   
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
I'm interested, @cynwulf, in how you came up with your numbers.  More specifically, how do you define an "element" such that you get ~343 possible arrangements for a three oligo puzzle?  I think this general notion of enumerating possible "templates" is on a lot of our minds, and perhaps you have a new insight.
Photo of cynwulf28

cynwulf28

  • 83 Posts
  • 26 Reply Likes

   My use of Elements was sequential in nature, but selectively so. That is, I was speaking of the reporter, and the three oligos A, B, and C when I spoke of elements, but I ALSO considered their complementary sequences as elements; i.e., R’, A’, B’, and C’. This gives 8 elements in total which I used in my rough estimates. I then considered the placement of each of these elements for a given lab. This placement considers all RNAs as a single unit, but goes from 5’-3’ along the designed RNA.

    For instance, in the [A]/[C]-DEC lab the very simplest placements would be rearrangements of the three main elements R, A, and C. Considering these elements alone, their placement along the designed RNA would give at least 3^3 =27 possible combinations, but that method of calculation would allow for such arrangements as RRR, and AAA and those clearly would not work for the puzzle. So, we must get clever with the math to exclude those arrangements. Using a simple calculation for permutations gives us 6 possible combinations for R, A, and C: {R,A,C} {R,C,A} {A,R,C} {A,C,R} {C,R,A} {C,A,R} **. If we necessitated the use of anti-oligo sequences (R’,A’,C’) then we would find that the number of possible combinations is much higher, being closer to 720:

{R,A,C,R',A',C'} {R,A,C,R',C',A'} {R,A,C,A',R',C'} {R,A,C,A',C',R'} {R,A,C,C',R',A'} {R,A,C,C',A',R'} {R,A,R',C,A',C'} {R,A,R',C,C',A'} {R,A,R',A',C,C'} {R,A,R',A',C',C} {R,A,R',C',C,A'} {R,A,R',C',A',C} {R,A,A',C,R',C'} {R,A,A',C,C',R'} {R,A,A',R',C,C'} {R,A,A',R',C',C} {R,A,A',C',C,R'} {R,A,A',C',R',C} {R,A,C',C,R',A'} {R,A,C',C,A',R'} {R,A,C',R',C,A'} {R,A,C',R',A',C} {R,A,C',A',C,R'} {R,A,C',A',R',C} {R,C,A,R',A',C'} {R,C,A,R',C',A'} {R,C,A,A',R',C'} {R,C,A,A',C',R'} {R,C,A,C',R',A'} {R,C,A,C',A',R'} {R,C,R',A,A',C'} {R,C,R',A,C',A'} {R,C,R',A',A,C'} {R,C,R',A',C',A} {R,C,R',C',A,A'} {R,C,R',C',A',A} {R,C,A',A,R',C'} {R,C,A',A,C',R'} {R,C,A',R',A,C'} {R,C,A',R',C',A} {R,C,A',C',A,R'} {R,C,A',C',R',A} {R,C,C',A,R',A'} {R,C,C',A,A',R'} {R,C,C',R',A,A'} {R,C,C',R',A',A} {R,C,C',A',A,R'} {R,C,C',A',R',A} {R,R',A,C,A',C'} {R,R',A,C,C',A'} {R,R',A,A',C,C'} {R,R',A,A',C',C} {R,R',A,C',C,A'} {R,R',A,C',A',C} {R,R',C,A,A',C'} {R,R',C,A,C',A'} {R,R',C,A',A,C'} {R,R',C,A',C',A} {R,R',C,C',A,A'} {R,R',C,C',A',A} {R,R',A',A,C,C'} {R,R',A',A,C',C} {R,R',A',C,A,C'} {R,R',A',C,C',A} {R,R',A',C',A,C} {R,R',A',C',C,A} {R,R',C',A,C,A'} {R,R',C',A,A',C} {R,R',C',C,A,A'} {R,R',C',C,A',A} {R,R',C',A',A,C} {R,R',C',A',C,A} {R,A',A,C,R',C'} {R,A',A,C,C',R'} {R,A',A,R',C,C'} {R,A',A,R',C',C} {R,A',A,C',C,R'} {R,A',A,C',R',C} {R,A',C,A,R',C'} {R,A',C,A,C',R'} {R,A',C,R',A,C'} {R,A',C,R',C',A} {R,A',C,C',A,R'} {R,A',C,C',R',A} {R,A',R',A,C,C'} {R,A',R',A,C',C} {R,A',R',C,A,C'} {R,A',R',C,C',A} {R,A',R',C',A,C} {R,A',R',C',C,A} {R,A',C',A,C,R'} {R,A',C',A,R',C} {R,A',C',C,A,R'} {R,A',C',C,R',A} {R,A',C',R',A,C} {R,A',C',R',C,A} {R,C',A,C,R',A'} {R,C',A,C,A',R'} {R,C',A,R',C,A'} {R,C',A,R',A',C} {R,C',A,A',C,R'} {R,C',A,A',R',C} {R,C',C,A,R',A'} {R,C',C,A,A',R'} {R,C',C,R',A,A'} {R,C',C,R',A',A} {R,C',C,A',A,R'} {R,C',C,A',R',A} {R,C',R',A,C,A'} {R,C',R',A,A',C} {R,C',R',C,A,A'} {R,C',R',C,A',A} {R,C',R',A',A,C} {R,C',R',A',C,A} {R,C',A',A,C,R'} {R,C',A',A,R',C} {R,C',A',C,A,R'} {R,C',A',C,R',A} {R,C',A',R',A,C} {R,C',A',R',C,A} {A,R,C,R',A',C'} {A,R,C,R',C',A'} {A,R,C,A',R',C'} {A,R,C,A',C',R'} {A,R,C,C',R',A'} {A,R,C,C',A',R'} {A,R,R',C,A',C'} {A,R,R',C,C',A'} {A,R,R',A',C,C'} {A,R,R',A',C',C} {A,R,R',C',C,A'} {A,R,R',C',A',C} {A,R,A',C,R',C'} {A,R,A',C,C',R'} {A,R,A',R',C,C'} {A,R,A',R',C',C} {A,R,A',C',C,R'} {A,R,A',C',R',C} {A,R,C',C,R',A'} {A,R,C',C,A',R'} {A,R,C',R',C,A'} {A,R,C',R',A',C} {A,R,C',A',C,R'} {A,R,C',A',R',C} {A,C,R,R',A',C'} {A,C,R,R',C',A'} {A,C,R,A',R',C'} {A,C,R,A',C',R'} {A,C,R,C',R',A'} {A,C,R,C',A',R'} {A,C,R',R,A',C'} {A,C,R',R,C',A'} {A,C,R',A',R,C'} {A,C,R',A',C',R} {A,C,R',C',R,A'} {A,C,R',C',A',R} {A,C,A',R,R',C'} {A,C,A',R,C',R'} {A,C,A',R',R,C'} {A,C,A',R',C',R} {A,C,A',C',R,R'} {A,C,A',C',R',R} {A,C,C',R,R',A'} {A,C,C',R,A',R'} {A,C,C',R',R,A'} {A,C,C',R',A',R} {A,C,C',A',R,R'} {A,C,C',A',R',R} {A,R',R,C,A',C'} {A,R',R,C,C',A'} {A,R',R,A',C,C'} {A,R',R,A',C',C} {A,R',R,C',C,A'} {A,R',R,C',A',C} {A,R',C,R,A',C'} {A,R',C,R,C',A'} {A,R',C,A',R,C'} {A,R',C,A',C',R} {A,R',C,C',R,A'} {A,R',C,C',A',R} {A,R',A',R,C,C'} {A,R',A',R,C',C} {A,R',A',C,R,C'} {A,R',A',C,C',R} {A,R',A',C',R,C} {A,R',A',C',C,R} {A,R',C',R,C,A'} {A,R',C',R,A',C} {A,R',C',C,R,A'} {A,R',C',C,A',R} {A,R',C',A',R,C} {A,R',C',A',C,R} {A,A',R,C,R',C'} {A,A',R,C,C',R'} {A,A',R,R',C,C'} {A,A',R,R',C',C} {A,A',R,C',C,R'} {A,A',R,C',R',C} {A,A',C,R,R',C'} {A,A',C,R,C',R'} {A,A',C,R',R,C'} {A,A',C,R',C',R} {A,A',C,C',R,R'} {A,A',C,C',R',R} {A,A',R',R,C,C'} {A,A',R',R,C',C} {A,A',R',C,R,C'} {A,A',R',C,C',R} {A,A',R',C',R,C} {A,A',R',C',C,R} {A,A',C',R,C,R'} {A,A',C',R,R',C} {A,A',C',C,R,R'} {A,A',C',C,R',R} {A,A',C',R',R,C} {A,A',C',R',C,R} {A,C',R,C,R',A'} {A,C',R,C,A',R'} {A,C',R,R',C,A'} {A,C',R,R',A',C} {A,C',R,A',C,R'} {A,C',R,A',R',C} {A,C',C,R,R',A'} {A,C',C,R,A',R'} {A,C',C,R',R,A'} {A,C',C,R',A',R} {A,C',C,A',R,R'} {A,C',C,A',R',R} {A,C',R',R,C,A'} {A,C',R',R,A',C} {A,C',R',C,R,A'} {A,C',R',C,A',R} {A,C',R',A',R,C} {A,C',R',A',C,R} {A,C',A',R,C,R'} {A,C',A',R,R',C} {A,C',A',C,R,R'} {A,C',A',C,R',R} {A,C',A',R',R,C} {A,C',A',R',C,R} {C,R,A,R',A',C'} {C,R,A,R',C',A'} {C,R,A,A',R',C'} {C,R,A,A',C',R'} {C,R,A,C',R',A'} {C,R,A,C',A',R'} {C,R,R',A,A',C'} {C,R,R',A,C',A'} {C,R,R',A',A,C'} {C,R,R',A',C',A} {C,R,R',C',A,A'} {C,R,R',C',A',A} {C,R,A',A,R',C'} {C,R,A',A,C',R'} {C,R,A',R',A,C'} {C,R,A',R',C',A} {C,R,A',C',A,R'} {C,R,A',C',R',A} {C,R,C',A,R',A'} {C,R,C',A,A',R'} {C,R,C',R',A,A'} {C,R,C',R',A',A} {C,R,C',A',A,R'} {C,R,C',A',R',A} {C,A,R,R',A',C'} {C,A,R,R',C',A'} {C,A,R,A',R',C'} {C,A,R,A',C',R'} {C,A,R,C',R',A'} {C,A,R,C',A',R'} {C,A,R',R,A',C'} {C,A,R',R,C',A'} {C,A,R',A',R,C'} {C,A,R',A',C',R} {C,A,R',C',R,A'} {C,A,R',C',A',R} {C,A,A',R,R',C'} {C,A,A',R,C',R'} {C,A,A',R',R,C'} {C,A,A',R',C',R} {C,A,A',C',R,R'} {C,A,A',C',R',R} {C,A,C',R,R',A'} {C,A,C',R,A',R'} {C,A,C',R',R,A'} {C,A,C',R',A',R} {C,A,C',A',R,R'} {C,A,C',A',R',R} {C,R',R,A,A',C'} {C,R',R,A,C',A'} {C,R',R,A',A,C'} {C,R',R,A',C',A} {C,R',R,C',A,A'} {C,R',R,C',A',A} {C,R',A,R,A',C'} {C,R',A,R,C',A'} {C,R',A,A',R,C'} {C,R',A,A',C',R} {C,R',A,C',R,A'} {C,R',A,C',A',R} {C,R',A',R,A,C'} {C,R',A',R,C',A} {C,R',A',A,R,C'} {C,R',A',A,C',R} {C,R',A',C',R,A} {C,R',A',C',A,R} {C,R',C',R,A,A'} {C,R',C',R,A',A} {C,R',C',A,R,A'} {C,R',C',A,A',R} {C,R',C',A',R,A} {C,R',C',A',A,R} {C,A',R,A,R',C'} {C,A',R,A,C',R'} {C,A',R,R',A,C'} {C,A',R,R',C',A} {C,A',R,C',A,R'} {C,A',R,C',R',A} {C,A',A,R,R',C'} {C,A',A,R,C',R'} {C,A',A,R',R,C'} {C,A',A,R',C',R} {C,A',A,C',R,R'} {C,A',A,C',R',R} {C,A',R',R,A,C'} {C,A',R',R,C',A} {C,A',R',A,R,C'} {C,A',R',A,C',R} {C,A',R',C',R,A} {C,A',R',C',A,R} {C,A',C',R,A,R'} {C,A',C',R,R',A} {C,A',C',A,R,R'} {C,A',C',A,R',R} {C,A',C',R',R,A} {C,A',C',R',A,R} {C,C',R,A,R',A'} {C,C',R,A,A',R'} {C,C',R,R',A,A'} {C,C',R,R',A',A} {C,C',R,A',A,R'} {C,C',R,A',R',A} {C,C',A,R,R',A'} {C,C',A,R,A',R'} {C,C',A,R',R,A'} {C,C',A,R',A',R} {C,C',A,A',R,R'} {C,C',A,A',R',R} {C,C',R',R,A,A'} {C,C',R',R,A',A} {C,C',R',A,R,A'} {C,C',R',A,A',R} {C,C',R',A',R,A} {C,C',R',A',A,R} {C,C',A',R,A,R'} {C,C',A',R,R',A} {C,C',A',A,R,R'} {C,C',A',A,R',R} {C,C',A',R',R,A} {C,C',A',R',A,R} {R',R,A,C,A',C'} {R',R,A,C,C',A'} {R',R,A,A',C,C'} {R',R,A,A',C',C} {R',R,A,C',C,A'} {R',R,A,C',A',C} {R',R,C,A,A',C'} {R',R,C,A,C',A'} {R',R,C,A',A,C'} {R',R,C,A',C',A} {R',R,C,C',A,A'} {R',R,C,C',A',A} {R',R,A',A,C,C'} {R',R,A',A,C',C} {R',R,A',C,A,C'} {R',R,A',C,C',A} {R',R,A',C',A,C} {R',R,A',C',C,A} {R',R,C',A,C,A'} {R',R,C',A,A',C} {R',R,C',C,A,A'} {R',R,C',C,A',A} {R',R,C',A',A,C} {R',R,C',A',C,A} {R',A,R,C,A',C'} {R',A,R,C,C',A'} {R',A,R,A',C,C'} {R',A,R,A',C',C} {R',A,R,C',C,A'} {R',A,R,C',A',C} {R',A,C,R,A',C'} {R',A,C,R,C',A'} {R',A,C,A',R,C'} {R',A,C,A',C',R} {R',A,C,C',R,A'} {R',A,C,C',A',R} {R',A,A',R,C,C'} {R',A,A',R,C',C} {R',A,A',C,R,C'} {R',A,A',C,C',R} {R',A,A',C',R,C} {R',A,A',C',C,R} {R',A,C',R,C,A'} {R',A,C',R,A',C} {R',A,C',C,R,A'} {R',A,C',C,A',R} {R',A,C',A',R,C} {R',A,C',A',C,R} {R',C,R,A,A',C'} {R',C,R,A,C',A'} {R',C,R,A',A,C'} {R',C,R,A',C',A} {R',C,R,C',A,A'} {R',C,R,C',A',A} {R',C,A,R,A',C'} {R',C,A,R,C',A'} {R',C,A,A',R,C'} {R',C,A,A',C',R} {R',C,A,C',R,A'} {R',C,A,C',A',R} {R',C,A',R,A,C'} {R',C,A',R,C',A} {R',C,A',A,R,C'} {R',C,A',A,C',R} {R',C,A',C',R,A} {R',C,A',C',A,R} {R',C,C',R,A,A'} {R',C,C',R,A',A} {R',C,C',A,R,A'} {R',C,C',A,A',R} {R',C,C',A',R,A} {R',C,C',A',A,R} {R',A',R,A,C,C'} {R',A',R,A,C',C} {R',A',R,C,A,C'} {R',A',R,C,C',A} {R',A',R,C',A,C} {R',A',R,C',C,A} {R',A',A,R,C,C'} {R',A',A,R,C',C} {R',A',A,C,R,C'} {R',A',A,C,C',R} {R',A',A,C',R,C} {R',A',A,C',C,R} {R',A',C,R,A,C'} {R',A',C,R,C',A} {R',A',C,A,R,C'} {R',A',C,A,C',R} {R',A',C,C',R,A} {R',A',C,C',A,R} {R',A',C',R,A,C} {R',A',C',R,C,A} {R',A',C',A,R,C} {R',A',C',A,C,R} {R',A',C',C,R,A} {R',A',C',C,A,R} {R',C',R,A,C,A'} {R',C',R,A,A',C} {R',C',R,C,A,A'} {R',C',R,C,A',A} {R',C',R,A',A,C} {R',C',R,A',C,A} {R',C',A,R,C,A'} {R',C',A,R,A',C} {R',C',A,C,R,A'} {R',C',A,C,A',R} {R',C',A,A',R,C} {R',C',A,A',C,R} {R',C',C,R,A,A'} {R',C',C,R,A',A} {R',C',C,A,R,A'} {R',C',C,A,A',R} {R',C',C,A',R,A} {R',C',C,A',A,R} {R',C',A',R,A,C} {R',C',A',R,C,A} {R',C',A',A,R,C} {R',C',A',A,C,R} {R',C',A',C,R,A} {R',C',A',C,A,R} {A',R,A,C,R',C'} {A',R,A,C,C',R'} {A',R,A,R',C,C'} {A',R,A,R',C',C} {A',R,A,C',C,R'} {A',R,A,C',R',C} {A',R,C,A,R',C'} {A',R,C,A,C',R'} {A',R,C,R',A,C'} {A',R,C,R',C',A} {A',R,C,C',A,R'} {A',R,C,C',R',A} {A',R,R',A,C,C'} {A',R,R',A,C',C} {A',R,R',C,A,C'} {A',R,R',C,C',A} {A',R,R',C',A,C} {A',R,R',C',C,A} {A',R,C',A,C,R'} {A',R,C',A,R',C} {A',R,C',C,A,R'} {A',R,C',C,R',A} {A',R,C',R',A,C} {A',R,C',R',C,A} {A',A,R,C,R',C'} {A',A,R,C,C',R'} {A',A,R,R',C,C'} {A',A,R,R',C',C} {A',A,R,C',C,R'} {A',A,R,C',R',C} {A',A,C,R,R',C'} {A',A,C,R,C',R'} {A',A,C,R',R,C'} {A',A,C,R',C',R} {A',A,C,C',R,R'} {A',A,C,C',R',R} {A',A,R',R,C,C'} {A',A,R',R,C',C} {A',A,R',C,R,C'} {A',A,R',C,C',R} {A',A,R',C',R,C} {A',A,R',C',C,R} {A',A,C',R,C,R'} {A',A,C',R,R',C} {A',A,C',C,R,R'} {A',A,C',C,R',R} {A',A,C',R',R,C} {A',A,C',R',C,R} {A',C,R,A,R',C'} {A',C,R,A,C',R'} {A',C,R,R',A,C'} {A',C,R,R',C',A} {A',C,R,C',A,R'} {A',C,R,C',R',A} {A',C,A,R,R',C'} {A',C,A,R,C',R'} {A',C,A,R',R,C'} {A',C,A,R',C',R} {A',C,A,C',R,R'} {A',C,A,C',R',R} {A',C,R',R,A,C'} {A',C,R',R,C',A} {A',C,R',A,R,C'} {A',C,R',A,C',R} {A',C,R',C',R,A} {A',C,R',C',A,R} {A',C,C',R,A,R'} {A',C,C',R,R',A} {A',C,C',A,R,R'} {A',C,C',A,R',R} {A',C,C',R',R,A} {A',C,C',R',A,R} {A',R',R,A,C,C'} {A',R',R,A,C',C} {A',R',R,C,A,C'} {A',R',R,C,C',A} {A',R',R,C',A,C} {A',R',R,C',C,A} {A',R',A,R,C,C'} {A',R',A,R,C',C} {A',R',A,C,R,C'} {A',R',A,C,C',R} {A',R',A,C',R,C} {A',R',A,C',C,R} {A',R',C,R,A,C'} {A',R',C,R,C',A} {A',R',C,A,R,C'} {A',R',C,A,C',R} {A',R',C,C',R,A} {A',R',C,C',A,R} {A',R',C',R,A,C} {A',R',C',R,C,A} {A',R',C',A,R,C} {A',R',C',A,C,R} {A',R',C',C,R,A} {A',R',C',C,A,R} {A',C',R,A,C,R'} {A',C',R,A,R',C} {A',C',R,C,A,R'} {A',C',R,C,R',A} {A',C',R,R',A,C} {A',C',R,R',C,A} {A',C',A,R,C,R'} {A',C',A,R,R',C} {A',C',A,C,R,R'} {A',C',A,C,R',R} {A',C',A,R',R,C} {A',C',A,R',C,R} {A',C',C,R,A,R'} {A',C',C,R,R',A} {A',C',C,A,R,R'} {A',C',C,A,R',R} {A',C',C,R',R,A} {A',C',C,R',A,R} {A',C',R',R,A,C} {A',C',R',R,C,A} {A',C',R',A,R,C} {A',C',R',A,C,R} {A',C',R',C,R,A} {A',C',R',C,A,R} {C',R,A,C,R',A'} {C',R,A,C,A',R'} {C',R,A,R',C,A'} {C',R,A,R',A',C} {C',R,A,A',C,R'} {C',R,A,A',R',C} {C',R,C,A,R',A'} {C',R,C,A,A',R'} {C',R,C,R',A,A'} {C',R,C,R',A',A} {C',R,C,A',A,R'} {C',R,C,A',R',A} {C',R,R',A,C,A'} {C',R,R',A,A',C} {C',R,R',C,A,A'} {C',R,R',C,A',A} {C',R,R',A',A,C} {C',R,R',A',C,A} {C',R,A',A,C,R'} {C',R,A',A,R',C} {C',R,A',C,A,R'} {C',R,A',C,R',A} {C',R,A',R',A,C} {C',R,A',R',C,A} {C',A,R,C,R',A'} {C',A,R,C,A',R'} {C',A,R,R',C,A'} {C',A,R,R',A',C} {C',A,R,A',C,R'} {C',A,R,A',R',C} {C',A,C,R,R',A'} {C',A,C,R,A',R'} {C',A,C,R',R,A'} {C',A,C,R',A',R} {C',A,C,A',R,R'} {C',A,C,A',R',R} {C',A,R',R,C,A'} {C',A,R',R,A',C} {C',A,R',C,R,A'} {C',A,R',C,A',R} {C',A,R',A',R,C} {C',A,R',A',C,R} {C',A,A',R,C,R'} {C',A,A',R,R',C} {C',A,A',C,R,R'} {C',A,A',C,R',R} {C',A,A',R',R,C} {C',A,A',R',C,R} {C',C,R,A,R',A'} {C',C,R,A,A',R'} {C',C,R,R',A,A'} {C',C,R,R',A',A} {C',C,R,A',A,R'} {C',C,R,A',R',A} {C',C,A,R,R',A'} {C',C,A,R,A',R'} {C',C,A,R',R,A'} {C',C,A,R',A',R} {C',C,A,A',R,R'} {C',C,A,A',R',R} {C',C,R',R,A,A'} {C',C,R',R,A',A} {C',C,R',A,R,A'} {C',C,R',A,A',R} {C',C,R',A',R,A} {C',C,R',A',A,R} {C',C,A',R,A,R'} {C',C,A',R,R',A} {C',C,A',A,R,R'} {C',C,A',A,R',R} {C',C,A',R',R,A} {C',C,A',R',A,R} {C',R',R,A,C,A'} {C',R',R,A,A',C} {C',R',R,C,A,A'} {C',R',R,C,A',A} {C',R',R,A',A,C} {C',R',R,A',C,A} {C',R',A,R,C,A'} {C',R',A,R,A',C} {C',R',A,C,R,A'} {C',R',A,C,A',R} {C',R',A,A',R,C} {C',R',A,A',C,R} {C',R',C,R,A,A'} {C',R',C,R,A',A} {C',R',C,A,R,A'} {C',R',C,A,A',R} {C',R',C,A',R,A} {C',R',C,A',A,R} {C',R',A',R,A,C} {C',R',A',R,C,A} {C',R',A',A,R,C} {C',R',A',A,C,R} {C',R',A',C,R,A} {C',R',A',C,A,R} {C',A',R,A,C,R'} {C',A',R,A,R',C} {C',A',R,C,A,R'} {C',A',R,C,R',A} {C',A',R,R',A,C} {C',A',R,R',C,A} {C',A',A,R,C,R'} {C',A',A,R,R',C} {C',A',A,C,R,R'} {C',A',A,C,R',R} {C',A',A,R',R,C} {C',A',A,R',C,R} {C',A',C,R,A,R'} {C',A',C,R,R',A} {C',A',C,A,R,R'} {C',A',C,A,R',R} {C',A',C,R',R,A} {C',A',C,R',A,R} {C',A',R',R,A,C} {C',A',R',R,C,A} {C',A',R',A,R,C} {C',A',R',A,C,R} {C',A',R',C,R,A} {C',A',R',C,A,R}.

 

Of course, we would not expect all of these combinations to work and indeed most of these could likely be excluded simply do to the impossibility of arranging these elements all on a single RNA of the length specified for the lab.

      There are two pseudo elements which complicate things. Note that for the above list that ALL elements are used for every permutation. We are not required to use them all and so may exclude any or all of those elements which are not explicitly required. In so doing we technically have made use of yet another element.... a null sequence, that is, an omission. We could treat omissions in their own right when performing calculations. The second pseudo-element arises from the overlap of any two of the elements given above. For example, I used the same sequence in the [A]/[C] labs to bind both A and C and in so doing utilized a hybrid compliment, not in part, but completely hybrid across the entire length of the oligos. I referred to the hybrid-binding site design as the Single-Site Exclusion model as only A or C could be bound at any time and NEVER both.

        I am less certain as to how to incorporate these pseudo-elements into calculations. As for the numbers I provided before.... They were VERY rough, the combinations I give here hint at something more refined.  

** for the list of permutations I utilized this site which seemed to get the job done: https://www.mathsisfun.com/combinatorics/combinations-permutations-calculator.html

           
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Switch puzzles relation to switch lab


This post isn't directly related to TB. However it is related to switch puzzles in general, plus Logic gate labs and OpenTB. These being both multi input and multi state puzzles.

This is about switch puzzles and about how they potentially relate to switch labs.

Recently Cynwulf asked me a question. Brewed down it adds up to this:

"I would imagine that there is a proportional correspondence between the number of possible states and the number of shapes you can make with a sequence of length=N. But HOW MANY could you have AT ONCE? I am not sure how to answer that." (I bring his full question below)



The more switch states - the simpler the (puzzle) solve



I think that goes for more states as well. Not just inputs. The more states, the stronger the magnet segments and base repeats. 

I have observed this for labs, but had yet to find a good puzzle example. Also this is related to the question Cynwulf asked.



Wwei23's multistate puzzles


Wwei23 has made a multistate series called Maximum Ride

I attempted solving the two puzzles with the fewest states a while back, with no luck. Then I tried the one with 21 states to day - suspecting it to be easier - and I recognized a pattern to it. After that I had no trouble at all solving the puzzles with the fewer states.

                 

These puzzles seems to not be solvable in a lot of ways. I started solving the puzzle with 21 states, by filling in U's. I put in one U, moved through the states and filled in more U's. I ended up with half the puzzle filled with U's at only one side. The other side A's. Then I started swapping in GC pairs for AU's, and added an occasional GU when needed.

What stood out to me in the puzzle with 21 states, was a pattern of mainly strong bases. Solely solved in two magnet segments. One half of the puzzle in one style of sequence pattern. Pyrimidine and the other in another Guanine.

I took a guess that this the puzzle with most states, wanted a more similar base solving style than the two puzzles with 13 and 19 states. These too took repetitive base sequence, but in slightly weaker versions.

Which highlights my point. The more states of a similar sized puzzle, the more locked up and shared the sequence becomes among the states.

Wwei noted to me today that Jnicol never has made any 4 state puzzles. This doesn't prevent his 2 and 3 state puzzles from being hellish hard. The hardest puzzles I have solved to this day, has been 3 and 4 state puzzles. Although admitted 5+ states also do give me trouble sometimes.

Wwei's puzzles have the pleasure of being hard, but still in reach of solving and while these puzzles and not lab puzzles, they may hint at the nature of lab switches.

Also take note of Cynwulfs switch puzzles. In a good deal of his kindest ones, he leaves a starting trail of sequence out as a helping hand. And this sequence will to a certain degree repeat itself - it being mirrored onto other sections of the switch with similar structure.


21 states of wonder

I wonder if it will be possible fitting more states into this 21 state Maximum Ride puzzle? What make me wonder is that there are still one weak base present in my solve (at base pairing position). Will the puzzle be solvable with even stronger bases?



Cynwulf conversation.


Here I bring the conversation between Cynwulf and I.


cynwulf28 → Eli Fisker  Fri Dec 15 2017

Hello, I found myself asking a question in chat (included below) which I feel has been investigated in the past, but for which I have never seen a paper or other reference addressing it specifically. I was Wondering if you knew of if there was a paper published for this or perhaps if you happen to know the answer yourself. 


cynwulf28: There are about 5270 switch puzzles [8:28 PM]

Astromon: cooL [8:28 PM]

cynwulf28: Of which, 2762 are Malcolm's Swiitches xD [8:29 PM]

cynwulf28: or Mods of his switches [8:29 PM]

Astromon: wow [8:29 PM]

Astromon: Master malcolm [8:30 PM]

wwei23: 3 states is the theoretical maximum for a 6 base puzzle. [8:30 PM]

cynwulf28: At 3 puzzles a day, that's about 920 days of publishing [8:30 PM]

wwei23: 7 states is the theoretical maximum for a 7 state. [8:30 PM]

cynwulf28: cool, good to know wwei23 [8:30 PM]

cynwulf28: for 7 base? [8:31 PM]

wwei23: Yes. [8:31 PM]

cynwulf28: I thought so :-) [8:31 PM]

wwei23: You might have seen my small 7 state switch. [8:31 PM]

wwei23: That's what it looks like. [8:31 PM]

cynwulf28: so is this relationship linear or exponential [8:31 PM]

wwei23: 8 bases is 13. [8:31 PM]

wwei23: I don't know. [8:31 PM]

cynwulf28: would we see the number explode for larger sequences [8:31 PM]

wwei23: 9 bases, I think I got 27. [8:31 PM]

wwei23: I think it would explode. [8:32 PM]

cynwulf28: makes sense [8:32 PM]

wwei23: It's unlikely that you can stabilize ALL the states. [8:32 PM]

cynwulf28: I would imagine that there is a proportional correspondence between the number of possible states and the number of shapes you can make with a sequence of length=N [8:33 PM]

cynwulf28: But HOW MANY could you have AT ONCE? I am not sure how to answer that [8:33 PM]


Eli Fisker → cynwulf28  Fri Dec 15 2017

Hi Cynwulf! 

I like your question. I haven't seen a paper on the topic. But I have the feeling you will be just the right person looking in the question. Don't wait around for it to be written. Investigate yourself! 

From my feeling of things structure don't get exponentially harder for the more state there gets. I think the more state, the more limits there are to what you can do. Like lab puzzle going more towards symmetry and simplicity. 

I have written a forum post about magnet segments getting reduced in numbers and stronger as the number of states grew. As I see the magnet segments gets stronger and more simplified (fewer of them) - in labs with more states. 

https://getsatisfaction.com/eternagame/topics/logic-gates?topic-reply-list[settings][filter_by]=all&...

Calculation wise, the relationship between sequence and multistate is exponential. However what I strongly suspect is that the sequence will get simpler and more repetitive. This is what I see for just two state puzzles. The sequence becomes more repetitive.

It is my feeling that the more states there get, the more the states will look somehow alike. Also structurally. 

You have made some pretty awesome puzzles. While the simulations aren't accurate, I think one way to investigate is to make puzzles. 

I have written another post and I have been thinking about you: 

https://getsatisfaction.com/eternagame/topics/how-eterna-players-can-generate-100-000-promising-open...

I would like you to focus at the bottom of it. I mention one of your puzzles and the similarity of the pattern in it. I would love if you made variations of it, but with different connection patterns between the ground pattern. If anyone can figure, it will be you. 

Puzzles are your strength, use them to investigate your ideas.

Good luck from here. 


message  Eli Fisker → cynwulf28  Fri Dec 15 2017

Also check these forum post, I think it is related to what you are asking about. It is kind of the why things need to get simpler for more states. 

https://getsatisfaction.com/eternagame/topics/logic-gates?topic-reply-list[settings][filter_by]=all&...

https://getsatisfaction.com/eternagame/topics/the-real-logic-challenge-using-nupack?topic-reply-list...

So there really are three different levels of repeats in switches. 1) First the simpler level base repeat. Repeat bases like AA, UU etc, in switches. 2) Then there are magnet segment repeats. Which repeat sequence of CU and GA. While their sequence is varied, they are doing the same thing. Making things switch and glide. 3) Then there are structural repeat. This is actually rather beautiful. I understand why you focus on symmetry with your puzzles.


Cynwulf replied to the challenge with the most beautiful puzzle: The Switchiest Switch

                    

I have yet to raise to the challenge of being able to solve it.
(Edited)
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 123 Reply Likes
eli, your post reminds me:

a little more than a year ago, eli and others wrote a nice paper on what makes a single-structure puzzle hard. that paper's ideas and 'eterna100' benchmark have been useful in inspiring new algorithms from my lab and others -- we'll post soon. it would be quite useful to have a similar paper on what makes a switch puzzle hard.  maybe something to put together after this openTB round completes!
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
We have the start here. ;)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

What makes a switch puzzle hard?



Things that will aid us with answering that question:


  1. Get the robots up and running on our switches as they ran on our single state puzzles in the past.



This will give us an idea of how to stall them best. This was the game within the game, we were playing that lead up to the first paper.



2)  Get Cody’s fractal and snowflakes scripts fixed.


Snowflake script

Fractal script


Cynwulf brought my attention that Cody Geary had made a snowflake script. Unfortunately it and its fractal partner script are broken. (See the puzzle comment section, it holds a description of the problem.)


Both are scripts that will be most useful for helping making switches. The fractal script even could spit out a solve to the generated structure too. The script could be adjusted so it spit out specific fractal structures.



The Snowflake Challenge




3) Get lots of switches made in particularly the following categories:


  • Snowflakes (Symmetry)
  • Fractals (Symmetry/asymmetry)
  • Switches with repeats of special elements (2-2 loops etc)
  • Switches with structure repeats
  • Asymmetric switches with variant element sizes.
  • Mirror switches (Where two states are the mirror state of each other
  • 3 states+ (As Cynwulf mentioned we have mostly 2 states puzzles)

If you put snowflake, fractal or such in the puzzle names, they will be easier to pull for a bot test later.

These are the main puzzle types that I think will help determine which kind of puzzles are hard for bots and humans. Plus show us where the switch bots gets in trouble.


The single state energy models are flawed in very specific ways. I think the switch bots are the same. Identifying those weak areas will help save calculations in the future and help the bots do better designs.

 

For more potentially interesting switch puzzle categories - and you may come up with some of them - see the post.


4) For help on making a switch puzzles, see the following guides:


How to create FMN switch puzzles by Nando

How to Create a Switch Puzzle by Jnicol

How to Create a Switch Puzzle as a Cloud Lab Candidate by Jnicol.

Guide to mirroring part 1 by JMF028

Leviathan by Cynwulf


5) Also you who are a scientist don’t have to wait to benefit from the switch ideas we have found useful for lab, if you can understand our pirate science lingo. I know for a fact that some of you do. ;)


Here is a sum up of some of the patterns that seems to work for lab switches.

(Edited)
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 123 Reply Likes
I like your proposal Eli! It does seem critical to get bots back up. One issue there is that there aren't actually published bots that solve switch challenges. Maybe we can convince elNando888 to publish vinnie and have it respond to all puzzles. If he agrees, I can certainly donate the needed supercomputer power.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Hi Rhiju!

I would very much like to get Vinnie running at our switch puzzles. I hope Nando says yes. From Vinnies solved puzzles list I can see it is a while since it has been running.

I also recall that you said some 3 years ago that EternaBot was the only bot in switch design town. EternaBot can make solves in our labs.

I would love to have EternaBot running too. Especially as I guess it is the plan that it should one day end up doing switch designs not just in our labs and preferably better than it is doing today. Not that the puzzles in particular will make EternaBot perform better, I suspect on the contrary. But finding where we can stall it, will still be useful knowledge. So if EternaBot gets to run on puzzles, I would like it to be split from the lab part. To not make it perform even worse in lab.

Additional loose thought. You said there aren't any published switch bots that can deal with switch challenge puzzles.

I wonder if there are any scientists with an unpublished switch bot who dare to have us test it?

      

Thx to RainbowArt and Bamenny for the images.
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Cynwulf, switches and repeat sequence


A certain someone has made switch puzzles so alluring that they have managed to drag me away from lab. 

Cynwulf has taken the use repeat sequence and repeat structure in switch puzzles to a whole new level.

He allowed me to share what he sent me recently. I hereby put our conversation up.

I strongly suspect this shall help us both for switch lab plus up the knowledge about making switch puzzles. 


Leviathan - A special sequence

 cynwulf28 → Eli Fisker  Thu Jan 04 2018

Eli Fisker, 

The switches I have made, which share a certain symmetry in how they switch, were all inspired by the same general sequence. 

I encountered this sequence while looking for ADAR-mediated A-to-I editing sites within mRNAs: 

AAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUG
CAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUGAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGA
UGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUUAGAAAACUCCA
UUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAA
GAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGA
UGCAGCAUGGAUAAAAAAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAA
GUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUGAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCA
GACUCCAUUUUCAAGUUGUGAUGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGG
AUAAGAAUUUAGAAAAACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGG
GCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUU
CAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAA


This sequence inspired me so much that I hacked the site to publish it as a switch, my "Leviathan" http://www.eternagame.org/game/puzzle/7817914/ . A quick note on the puzzle I made, it was supposed to employ the standard ligand boost of -4.86 kcal, but sadly published instead with an older standard of -2.51 kcal....so I don't know if it is solvable. However, if you are curious, you can paste the sequence in and then Beam to puzzle-maker and replace the boost in State 2 with the proper boost from the puzzle-maker tools and the puzzle WILL stabilize.

     
http://www.eternagame.org/sites/default/files/chat_screens/233206_1515022823.png 



The sequence naturally occurs in the human gene FBN1 (Fibrillin 1) https://www.ncbi.nlm.nih.gov/gene/2200 . It is essentially the same sequence mapped on top of itself starting at position 60 or so if I recall correctly. Either way, I wished to share this with you. The sequence above was modified slightly to avoid overlap when publishing, but is otherwise the same as that found within the gene and its corresponding RNAs. 




Eli Fisker → cynwulf28  Thu Jan 04 2018Hi Cynwulf! 

Thx for sending this to me. I had been admiring the puzzle from a distance. 

What a great catch. You have found yourself a sequence that itself sparks symmetry. Because of its repetitive nature. It's like it was made to switch. 

I beamed the puzzle to the puzzle maker but didn't get to stabilize it fully. I put the molecule boost at base 445 as in second state of the puzzle. I may have done something wrong. Or the puzzlemaker has something changed. 

Instead I drew on your image.

         https//d2r1vs3d9006apcloudfrontnet/s3_images/1688863/RackMultipart20180104-20298-1t9z82v-Cynwulf_s_Leviathan_inlinepng1515063717
https://d2r1vs3d9006ap.cloudfront.net/s3_images/1688863/RackMultipart20180104-20298-1t9z82v-Cynwulf_...

I have some thoughts back. Overall there seems to be an equal number of two different sequences, that sparks two different structures. They are stuck in between each other like a harmonica. However some of the structures are slightly variations. Are there sequence variances at those spots too? Or are the mRNA made up of true repeats?

One more thing I wonder about. Could the puzzle be solved if it were not a mix of every second structure in between each other, but lets say, there were two of the structures with the green highlight for every two of the blue highlights? 

I suspect you can take the same basic repeat sequence and break it up in different ways and create new switches with different structures. 


I have tried count and it seems like the repeat sequence consists of a 25 (green stretch) and 28 bases (blue stretch). So 53 bases all in all for the two stretches. I wonder if you could create a similar puzzle, by changing some of the bases in the sequence, but still let it repeat the same way. So the stretch being the same length and repeat in the same way, but with a few bases changed?


Eli Fisker → cynwulf28  Thu Jan 04 2018

Now I also wonder how you got to the structure (dot bracket) in the first place.



cynwulf28 → Eli Fisker  Thu Jan 04 2018

I played around with the original sequence in puzzle maker....I started by simply pasting the original sequence into a large enough design to allow for all of the bases to paste, then I switched from target to natural mode, and made a single modification to turn that natural mode into the target design. 

Here is the ACTUAL original sequence from the gene FBN1: 

GATGCTATGTGGGGGTTCTTTCCAGTTCCAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCAT
GAATAAGAATTCAGACTCCATTTTCAAGTTGTGATCAGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCC
ATTTTCAAGTTGTGATCAGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATGAG
GCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATGCGGCGGATGCAGCATGGATAA
GAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTC
AAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCG
GATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAA
TTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAAAGCTGGCGTACGTGATGTGAC
TATAAAATAGT 



To follow up on the harmonica metaphor, the sequence seems to have been stamped over itself nine times. I ran a BLAST of this sequence against itself and got the result foud here https://blast.ncbi.nlm.nih.gov/Blast.cgi (page has expiration after a short time, but the BLAST can easily be repeated if necessary)

I also ran this sequence through the RNAfold server: 
http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi?PAGE=3&ID=jIE_PjOZsq 

And here is a Dot Plot found on that page:


http://rna.tbi.univie.ac.at/RNAfold/jIE_PjOZsq/sequence1_dp.pdf


Eli Fisker → cynwulf28  Thu Jan 04 2018

Thx for your additional explaining. This is super cool. There are even repeats in the entropy plot. :) 

So you used the natural fold in the puzzle maker to make the structure. I did a try myself to get the structure and what I tried was run the reduced main part of the sequence through Vienna RNAfold in multiple repeats to get a structure but didn't get very far. 

I really like what you have done. I would love if you would one day write down your thoughts on your puzzle making as you explain them here to me and post them in the forum. I suspect that we will learn quite a lot. Especially because switch puzzles seems to be tied more up with lab, than are static puzzles are. I suspect there will be a spill over from learning from puzzle switches that shall prove helpful for lab designing.





(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
@cynwulf28 This is fascinating, to find this structure and switching functionality in a natural RNA!  You said it was from an mRNA, but what else do you know?  Is it part of a reading frame?  Is its role in the mRNA known?

@eli Thanks so much for posting this!  It seems like this could/should be the start of a topic of its own.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
@omei, feel free to start a switch puzzle analysis discussion post.

I can see that I got the Leviathan puzzle sequence Cynwulf sent me, split up in several sections. Seems to be some message format thing. Hereby I try correct:

AAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUGAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUUAGAAAACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAAAAAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUGAGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUUAGAAAAACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAAGAAUUCAGACUCCAUUUUCAAGUUGUGAUCGGGCGGCGGAUGCAGCAUGGAUAA

The same happened with the FBN1 gene sequence:

GATGCTATGTGGGGGTTCTTTCCAGTTCCAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGAATAAGAATTCAGACTCCATTTTCAAGTTGTGATCAGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCAGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATGAGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAGAATTCAGACTCCATTTTCAAGTTGTGATCGGGCGGCGGATGCAGCATGGATAAAAGCTGGCGTACGTGATGTGACTATAAAATAGT
Photo of cynwulf28

cynwulf28

  • 83 Posts
  • 26 Reply Likes
@Omei, the sequence is almost in the center of the Gene and lays within an intron. I found it while designing primers for the purpose mentioned above and as a check, I BLASTed the whole Gene against itself to make sure that I wasn't trying to amplify a repeat-containing sequence. The sequence is between positions (complement) 48529806 and 48530405 of Human Chromosome 15.
   That being said, the RNA-Seq does show a slight spike at the region. It is entirely possible that this sequence is expressed as a regulatory RNA, but in any case it doesn't seem to be annotated within the gene record as being anything of interest. It might be a viral remnant...I admit I haven't looked into it much. In the end, if no actual function were found to belong to this sequence, I think it still serves as one of those beautiful artworks of nature, but something tells me that this sequence is more than a mere showpiece.  
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Input concentrations matter - length of inputs complements too


For solving the ABC2INC puzzle for first round OpenTB, I focused on concentrations alone. Using them to tip the balancing point between states. Lately I have been thinking about that we  could also use the binding length of the inputs, to also tip balance between states.



Winner sequences with large touch zone


What characterises a good deal of the best ABC2DEC and ABC2INC designs? Their sequences have a large touch up zone with the inputs.


This made me think about if there were a way we could use input binding length to cover up for the low concentrations of A and B in state 4. If we could make the binding with A and B full length, but also make sure they went well away, when concentration of both were not present.



Making the most likely RNA fold


While I have been talking a lot of entangled hairpins this round, lately I have been thinking a lot about unentangled hairpins and that being worth a shot also. From what I have seen in RNA the statistically most likely fold that happens most often, is the nearest neighbour strand pairing. It is therefore hairpin loops and stems are so frequent. Multiloops and internal loops form frequently, but a bit rarer. Yet rarer are long range crossovers. This is what I have seen for static RNA. It may not work this way for switch RNA.



How to gain most possible touch between sequence and inputs?


An approach to doing so is to either make the input complement make a hairpin with itself, or to make the input complement make a hairpin together with the reporter. Most of the sequence of the input complements sequence will be intact and ready for an almost full bind with the RNA design. When no longer packed away.



Atanas C locks


I took note of Atanas round 2 designs for ACINC and BCINC.


They were rather different. They put the reporter and the A or B input shared state with next to each other. No surprize there. That is generally a good strategy for an input one wants turned on.


This design were among the better for the ACINC sublab.


http://www.eternagame.org/game/solution/7113323/7250058/copyandview/


It was rather the turnoff that was surprising. The C input needed to be alone in the first state. This was done by it pairing in both sides of the A input and reporter, thus hiding them away. The reporter was made fold up with the A input. A few bases were changed to make sure the input and reporter could make a hairpin together. But mostly their whole sequence were preserved so they could do a full bind up when they needed to go into action.



Competition of input lengths for making a massive turnon



With this drawing I try to illustrate how inputs may be packed up with them selves and away for some states, but packed out for full pairing, in another state. This is based on an ABC2INC design I made this round. (See second image below)

Showing there is a big difference in amount of binding bases per state. State 1-3 should be like a harmonica, with input A, B and R each folded up with itselves. And state 4 should be the massive readout where every input should be bound up, the C’s also.



I have made each input complement fold up with itself and being away in some states. Similar I made the reporter fold up with itself. And I made the C input bind on both sides of all of that in state 1-3.



Packaway sequence with maximum touch


I decided I would try this approach in the two hard labs. By fusing two such puzzles.



It isn’t stable. So it may not work. I’m however interested enough to find out what lab thinks about it.


Also I’m aware that I may not get one C binding across the whole puzzle but rather two at each their end, as in the last state.


Still I think this is worth a shot. I have tried a similar approach in the ABC2DEC lab.

(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Reporter transplant - Reusing successful structure from earlier labs


This is a lab discussion between Omei and I. I mentioned a new found realization to him about reusing structural parts from past switches to solve new switch puzzles. The discussion expanded into other topics and since I think this will be useful to us in general, I share it. I have added a few extra images and links afterwards.



eli [8:53 PM]

By the way, I finally had success with something I have struggled with for lab.

I have had trouble making stable designs of the type I really wanted to make.

It was something very specific that ended landing me the success.


omei [8:53 PM]

I'm all ears for that!


eli [8:54 PM]

http://www.eternagame.org/game/browse/8489874/?filter1_arg2=8591496&filter1_arg1=8591496&filter1=Id



eli [8:54 PM]

I could get state 1-3 stable but not get the reporter off

Or many other combinations of states - 3 stable, always one unstable

What changed my whole perspective and success, was when I thought about AndrewKae's design.

I wanted the reporter next to the C input. Just as he had in his lab.

So I decided to do a reporter transplant

along with a part of the C input complement.

The point was taking a reporter complement and its turnoff complement that I knew to be working

Both for being stable and for solving in lab.

I couldn't do the job fully with AndrewKae's version, so I nicked a part of Whbob's design too.


eli [8:57 PM]

http://www.eternagame.org/game/browse/8489874/?filter1=Id&filter1_arg2=8591054&filter1_arg1=8591054


eli [8:57 PM]

So basically it is an old idea recycled. But more radical.

I have before borrowed MS2 turnoffs from one lab and made them work in another lab. But I have not taken bigger sections, as this is.

I basically think this can help for switch lab solving. Both solving + make designs work in lab also.

That was my story :)


omei [8:59 PM]

Absolutely.


eli [9:00 PM]

Plus the design I made working is of a new type for the hard labs.


omei [9:01 PM]

Can you distill this down to a simple C sensor?


eli [9:01 PM]

I have taken what Atanas did in a smaller lab, and followed the logic continuation.

Moment

I can for the slightly bigger lab.

http://www.eternagame.org/game/browse/8489870/?filter1=Id&filter1_arg2=8560950&filter1_arg1=8560950

This design uses some of the same principle

Here the C input reaches on both side of B and R

In the hard lab, I put R outside.

I basically made A and B each fold with themselves so they are away most of the time. Unless concentration of both of them are strong.

Here is one of the hard dec designs. Flip around between the states and I think you will see what I mean.

http://www.eternagame.org/game/browse/8489874/?filter1_arg2=8591496&filter1_arg1=8591496&filter1=Id

And illustrated with Sensor C


eli [9:11 PM]


[Sequence: AAAAAAAAAAAAAAAAAAAAAAAAAAAAACCACCUGUGUCAGAACUUAGUCUCUCUAUGUACAAAAAAAAAAAAAAAAAAAAAAA , lab: http://www.eternagame.org/game/browse/8489860/ ]


eli [9:12 PM]

The basic principle behind this kind of puzzle is that it relies not only on concentration. But also of the length of the inputs. Because in this kind of design, most of the input length gets used.

So while concentration of A and B is weak, I give them strength by having them appear both at once and in rather long stretches.

But have them packed away as both are not present.

By locking them in by one sole C input.


omei [9:14 PM]

Yes, I can see the pattern (i.e. "Let the oligo complement fold itself into a hairpin when it isn't bound") as the unifying principle in both the simple case and your full puzzle solution.


eli [9:14 PM]

Exactly!

I'm really happy I got it stable.

I might not have realized the reusability part, had I not struggled. (edited)

I mean had I had no trouble solving, I wouldn't have thought about reusing parts.


omei [9:17 PM]

I've seen hairpins like this in Brourd/Nando designs, but I'm not sure they got them in this specific way.  It seems like this has the potential for being a very basic tool.


eli [9:18 PM]

Yes the ground structure of mine resembles theirs very much. However there is overlap between stems in the states.

I mean, strands from one stem overlap half and half between states. So the stems struggle

They are not structures on their own.



What I used is the nearest neighbour strand principle. That two strands next to each other that have matching sequences, would very much like to pair

Instead of long distance folds that are more rare.

I made the structures share joints.

So long distance folds do happen. I'm counting on that for the C to lock down the structure holding A and B folded.


omei [9:23 PM]

A heuristic I have been trying in recent rounds, but not yet gotten good data on, is to not "fight" any helix formation showing up in the dot plot.  But stated this way, it serves more as a check of a tentative design.  Your's is more of a method of construction, which is more useful.


eli [9:23 PM]

The inputs do not fully match for a pair up with themselves, and neither should they (they would be bad inputs then - more happy to bind with themselves than interact)

But what I did is to tack on two GC pairs at bottom of the input complement hairpin stem


omei [9:24 PM]

It sounds like there are multiple ways to view these designs; we seem to be coming from somewhat different angles.


eli [9:25 PM]

Which is why it is inspiring discussing.

:)

And this was the design of mine I intended showing, I somehow ended up showing its partner. This one is the more symmetric.


omei [9:29 PM]

BTW, do you evidence for the statement "The inputs do not fully match for a pair up with themselves, and neither should they (they would be bad inputs then - more happy to bind with themselves than interact)"?


eli [9:29 PM]


eli [9:29 PM]

I only have "evidence" in form of my observation. I noticed that natural microRNA's, the ones I checked seemed to have a particular sequence bias.

So that they would not pair with themselves strongly.

The ones I ran through vienna came out with high entropy

Something not to be expected for something that can form a hairpin.

I have used this observation when I cut the TB biomarkers

So I can't prove I'm right. Although I strongly suspect that I am. :)

You are far better in the proof department. :)


omei [9:36 PM]

I know that we "all" agreed that our oligos shouldn't form strong hairpins.  Intuitively that makes sense.  But it seems like the kind of assumption that blind one to new possibilities.  That's why I asked, not that I had evidence to the contrary.


eli [9:37 PM]

Excellent point. Actually my new design type would be the first kind of design that could benefit if that was the case. ;)

I mean if the input could make a weak hairpin with itself, but open up to its complement make a somewhat stronger bind - so I didn't need to tag extra bases onto the bottom of the hairpin forming of the complement.


omei [9:38 PM]

I think micro RNAs typically have very low affinity, which would make them poor switches when evaluated by fold change.  I think for their purpose, specificity is more critical than fold change. (edited)


eli [9:39 PM]

My aim with this design type was to have as many of the bases in the sequence actually pair up with the inputs. In other words maximum touch.

That is a really good point.

Although I did find a paper stating that two miRNA's could compete for the same landing spot.

I was wondering about it.


omei [9:41 PM]

This is wandering from your initial point, but I do think specificity is going to be a big issue when we try to test actual blood.


eli [9:41 PM]

Happily follow. That was also part of what I was trying to aim towards.

To have long stretches of the inputs pair up.

But unfortunately mismatches and weaker bases are needed to make a solve to the labs

Except Nando/Brourds design type

Those generally couldn't (edited)


omei [9:42 PM]

I think there may be another reason they are important.


eli [9:43 PM]

tolerate mismatches (edited)


omei [9:44 PM]

... and that is to break up unwanted cooperative binding between two oligos (which are intended to be competing for a shared sequence) due to the coaxial stacking bonus when both bind.


eli [9:45 PM]

Good point.

But there are no shared sequence in neither Brourd/Nando's or my new design type.



omei [9:47 PM]

And that's where I am thinking that these designs may have their advantage.  Not necessarily larger fold changes, but better specificity.

... which wouldn't be appreciated by our normal scoring.


eli [9:49 PM]

I wonder if there would be any way to pick these designs out. Would your Central Fold change help show this better?


omei [9:54 PM]

I don't think so.  The way I usually pick them out is by comparing the simple conditions.  For example, take a A*B/C^2 INC design.  Now look at the KD ON values for no ligand, 100nM_A,  100nM_C and 100nm_A_C.

We would expect  the 100nM_A KD to be lower than KD_noligand, (i.e. increase the reporter binding),  KC 100nM_C KD to be higher, and KD 100nm_A_C somewhere between just A and just C.

But what often happens is that A and C together result in lower KDs that either A by itself or C by itself.\

In all the cases I have looked at, this can be explained by the A and C actually both binding, instead of one of them kicking the other out, because that's the lowest energy configuration once the coaxial stacking effect is considered.

So it is looking at these simplified test concentrations that I would try to use to pull out designs that might have this problem.


eli [10:03 PM]

So this is specifically a problem of lane sharing in the hard labs.

Another thing. Brourd/Nando's designs seemed to have their A and B inputs behave more similar in relation to concentration. Probably also due to what you mention above.


omei [10:05 PM]

Yes, if I understand your terminology correctly.  But it can also be a source of strength.  For example, an A and B complement might overlap with a result that was good.

But getting back to the specificity, I'm concerned that other oligos in the blood will take advantage of this phenomenon even if they have a relatively short matching bases -- say 6.


eli [10:08 PM]

That is a very good point.

Thx for a good discussion. This has been most helpful.

(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes

Bad bot breaking constraints


Someone ought to tell our bot that this is a bad idea... :)



I know that nature allows longer stretches of G’s and C’s, but that lab has a problem with them.


Only 3 get a fold change error below 1.25. None of the designs score above 60.



Similar only 3 designs gets a fold change error below 1.25. None of the designs score above 60.


EternaBot also allows too long stretches of A and U. Although it takes slightly more of these to trigger lab and score problems.

I stumbled on the problem eterna bot designs, as I was taking a look at the error rates in the TB labs. I I was checking up on if longer stretches of G and U also triggered score and fold change error problems, just as it did in the latest Riboswitch and kissing loop labs.