Player/dev collaboration needed to create an effective, rapid, in-round Select-Test-Publish-Analyze cycle.

  • 7
  • Problem
  • Updated 9 months ago
  • (Edited)
There are a lot of steps needed to transform our success in OpenTB Round 2 into a working diagnostic. The Gates foundation has given the Das Lab a grant for the "hardware" part of that transformation.  But when the dev team started thinking in more detail about the whole process, we realized the weakest link in the current process is getting rapid player feedback, in terms of new designs that address changing requirements, as the engineer/experimentalists narrow down the detailed design of a point-of-care device.

The most obvious case-in-point of this is getting array results for the Round 4 OpenTB designs. This has been an issue because Johan Andreasson, the post-doc who helped pioneer this technique and who personally conducted the Eterna array experiments, has gone on to a new job. He is still available for consultation, but can't spend the time needed to guide the experiment through its many steps. Fortunately, Feriel Melaine, the new post-doc who has successfully replicated the array results for the AK2.5 design, but with a bead-based experiment, has now agreed to take on the task of getting us array-based results for the Round 4 designs.

But in addition to that, we realized that we didn't really have adequate structure in place to do a rapid test cycle on the order of one every two weeks. The lab believes they can get their part of the work (receive the list of designs, order and receive the DNA templates needed as inputs to the experiments, run the experiments and return the data to players) in one week.  But a two week cycle implies that players would then have only one week to look at the results, analyze them, disseminate that analysis to other players to create and submit new versions of their designs and then collectively decide on which designs should be submitted to start the next rapid feedback cycle. We have no precedent for having done that before.  Now, we need to create a process to do that, and we'll be using the extended Light-up Sensors project as our testing ground.

Hoping to help organize the discussion a bit, I propose subdividing the discussion of the player part of the process into some individual steps. Starting with the next step falling into players' laps with the first 6 designs (currently in the lab):
  1. Players (typically the more experienced ones) analyze the results and try to distill what it "means".
  2. Analyses are disseminated in a form that is easily accessible by all lab players.
  3. Players submit new designs based on what they think they have learned from the analysis and subsequent discussion.
  4. Players select a new set of designs for the next rapid feedback cycle.
I'll immediately follow up with a separate "Reply" on each of these substeps, and if that organization fits with what you want to say, you can "Comment" on the corresponding "Reply".  But there's no need to feel constrained to that structure if you choose.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 977 Posts
  • 307 Reply Likes

Posted 1 year ago

  • 7
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes

Zama’s Secret Sauce to spirals



As Zama said: I made that recipe looking only at the spinach- never liked spinach


Here is a lab discussion between Zama, I and later Omei too from a few days back.


Zama: @channel, here is the list for Trypto A SS Spinach. I didn't take the time to add links but the names are included and each is followed by a screenshot of the arcplot. I made a note if there were other similar mods. *The Secret Sauce*" for spotting a spiral (at least in this lab) is- *No multiloops in State 1, although a small hairpin near the static neck might be tolerated.* (edited)


Trypto A- SS- Spinach Spirals Google Doc - aka Zama’s book of spirals



Eli: Beautiful collection - big thx!


Zama: I'd love to hear everyone's opinion on which are best?


Eli: So far I like Dl2007's the best as they are fairly clean and very green.


There is one of Mee's looking real good too.


I'm basing this solely on color visuals.


The one of Mee's is the one with 0301 in the title


Zama: What about the last one- Astromon's?


Eli: It has some darker lines in the background on the top half of the arc plot


that may want to fold differently


But not bad.


One thing I notice is that many of these spirals have a little bit of circularized nature in them.


Zama: Can you define or give an example of what you mean?


Eli: Here is a more pure spiral by tone


https://eternagame.org/game/browse/8789142/?filter1=Id&filter1_arg2=8950120&filter1_arg1=8950120


I can't say for sure that the more pure version will do better than the slightly less spirally. Because the best FMN/MS2 aptamer with the best fold change so far for riboswitches, had an almost pure spirally pattern, but with a slight turn in the middle.


Zama: Can you give an example of what you call circular?


Eli: The ones that are like yin and yang shapes


if you draw a line through them, they are ring like as they can often be connected


while they are not round circles


more like salvador dali circles :)


or watches


Zama:


Like this- with it setting on top of a spiral?


Eli: Example of circularized arc plot

https://eternagame.org/game/browse/6369186/?filter1=Id&filter1_arg2=6423405&filter1_arg1=6423405


And the design you show above is a spiral


let me see if I can find one of the mixtures


Zama: I saw tons of those- they are the ones with the multiloops.  Were you saying you were seeing a lot of circulars in my collection?


Eli: No, Zama.


Just that a few of them have a slight hint of the circularized arc plot


Lots of designs in the labs aren't pure forms, but mixtures


Zama: Ah, that's where I got confused- and yes, some are on the border.


Eli: Well observed


And sometimes it also happens in the middle


Ok, here is one - actually one of those I like for their clean look.


I cheated a little and drew just the border



It has that yin and yang border feature


despite also being a spiral


Zama: Yes, those differ considerably to the kind of spiral we got in round 1- like Jieux's.



Eli: Yes



Notice that stem highlighted in state 1. This is the one giving the change.


Normally both moving part in both states of a pure spiral design will look very much the same.


They will be two or three switching stems in line. And all that happens is that they swap their partners for different ones between states.


Zama: Yea, that's one of those little hairpins in the static neck loop that seem to be tolerated.


The ones I were referring to- nice to know what they do


Eli: Yes


Example of the stems lining up in spiral designs:



Zama: Yep, no multiloops


Eli: Well put


I marked all the switching bases that pairs. Most of them become paired in both states


On the no multiloop observation, the spiral designs behave quite opposite to the circularized designs. The latter seems to make a virtue out of getting multiloops in.


Omei: I think the difference between a "pure spiral" and the "almost pure spiral" of the best FMN/MS2 designs is a very significant difference.


A pure spiral implies the absence of a multi-loop, and hence only a single hairpin loop. As I recall, one of the first things we measured in the earliest array labs were the number of hairpins in each state, and those with only one hairpin in each state, on the whole, were the worst group.


I think it is quite possible that pure spirals will turn out to have good fold changes, perhaps the best, but only if the experiments are done differently, i.e. allow more time to pass between changing conditions, to give the slower full spiral switches time to come to equilibrium.


This time factor (which the lab coats refer to as kinetics, as opposed to thermodynamics, is something that Eterna has tended to ignore, largely because the science of RNA kinetics really lags behind that of RNA thermodynamics.


Eli: Double aptamer design with best fold change 157


At first when I drew it up on paper, I thought it to be a true spiral, but it has a little detour from the spiral pattern in the middle.



I have been wondering if we can make a true spiral work in such a lab or if it would need a little longer sequence.


Omei:  That would probably make it switch even more slowly, making it appear to be worse in the current experiments.


Eli: Yes, so a defect added somewhere strategic, while spoiling the pattern a little, may work the best.


Omei: I argued for Eterna to explicitly address kinetics questions. Rhiju was interested in talking about it, and came up with medical scenario where it would be important.


But there's too many other things going on right now, I think, to introduce that as new types of puzzles.


What I do think is possible is to start getting players talking about the significance of switching speed, so we can ask the experimenters to routinely publish the timing of the various steps for each round. If nothing else, that will give us a baseline for comparing results with future experiments that do explicitly treat time as an experimental variable.




Photo of Benbennett1

Benbennett1

  • 24 Posts
  • 3 Reply Likes
i think you are over complicating this. the main goal should be to have as little faint bonds as possible. none of this spiral stuff looks like it would help anything it seems. the goal is to get the arc plot to match the puzzle with as little interference as possible

Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Correct - a messy arc plot is not a goal in itself. Recently jandersonlee did some calculations over past lab designs that showed that the winning designs tend to have more clean arc plots. I start solving as I can, and as a consequence my plots are regularly messy. You are welcome to clean them up. 
Photo of Astromon

Astromon

  • 192 Posts
  • 25 Reply Likes
Poll seemed to change the direction of the spiral by orientating the Aptamer in the opposite placement of it.   https://getsatisfaction.com/eternagame/topics/player-dev-collaboration-needed-to-create-an-effective...
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Well noticed, Astromon!


Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes

Here are two inverted spirals from the Tryptophan B Same State (Spinach) lab


Counterclockwise spiral and clockwise spiral




Clockwise spiral (left spiral arc-plot)

https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002640&filter1_arg1=9002640


Counterclockwise spiral (right spiral arc-plot)

https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002443&filter1_arg1=9002443


This one is a near pure spiral, but has a tiny stem forming (aptamer selfturnoff).


Photo of Benbennett1

Benbennett1

  • 24 Posts
  • 3 Reply Likes
i think you are focusing on the wrong issue. this has nothing to do with spirals. its got to do with matching probabilites rather than making a nice spiral. the arc plot is just a tool to prune potential interference to work in the wet lab
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Benbennet, you are correct that RNA do not make a literal spiral in lab, but in the arc plot. The reason I take interest in spirals in arc plots are that they have turned up in exceptional past lab winners.

https://getsatisfaction.com/eternagame/topics/player-dev-collaboration-needed-to-create-an-effective...
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes

The seed of the spiral orientation


There seems to be a pattern for the orientation of the spiral in relation to how the puzzle looks. The way the design bends around the turned off aptamer, hints of the orientation of the spiral. 

  • If the design bends clockwise, the spiral bends clockwise
  • If the design bends counterclockwise, the spiral bends counterclockwise


Exclusion Example

https://eternagame.org/game/browse/8791823/?filter1=Id&filter1_arg2=9006204&filter1_arg1=9006204

https://eternagame.org/game/browse/8791823/?filter1=Id&filter1_arg2=9006118&filter1_arg1=9006118


Same State Example

https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002640&filter1_arg1=9002640

https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=9002443&filter1_arg1=9002443


In the Tryptophan designs it seems to be the tryptophan aptamer that is strongest and decides the orientation of the spiral. Same for designs with theophylline (at least those labs I have managed to make spirals in so far). Where as for the differently typed Exclusion FMN designs, it appears to be FMN that controls the spiral action.


Challenge

Now this spiral pattern being closely connected with the design bend seems a emerging trend. 

What I will be very interested in, can you guys make exceptions?

Can you make: 
  • designs that bends clockwise, but have the spiral bend counterclockwise?
  • designs that bends counterclockwise but have the spiral bend clockwise?

Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
Does this one count?
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
This is a more scrunched up progression of the previous


Or is using an FMN exclusion lab cheating a bit?
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Poll na gColm, thx for testing this out. 

This makes me realize that I should have added some more advice. So hereby my apology. 

The switching area in the design needs to have switching stem moving after each other in a line. Small stems in the switching area seems to break the spirally area.  

Keep up the testing.  
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Also it is okay to use the FMN exclusion too. That is no cheating. For now it seems it behave in a similar way bespite being an OFF switch and the others are ON switches. 

And I do give you points for solving the task as I stated it. I didn't specify well enough. 
(Edited)
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes

This is as close as I've managed so far for Tryptophan B Same State MGA
Photo of Benbennett1

Benbennett1

  • 24 Posts
  • 3 Reply Likes
i think this is mainly going into basic geometry. these spirals arent really important. its just the rna flattened and the bonds drawn as arcs. you need to focus on those faint lines in the center left, as there is a small chance to mismatch there
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes

Static stem deletion mystery solved


A while back I was wondering if the static stem that tended to turn up at specific spots in the switching area in lab designs were having a function. (Background forum post - See the section No static stem) Beyond the more obvious benefit of hiding away excess bases.


I got a chance to test this in round 101 where we got 8 sublabs with the FMN/MS2 riboswitches labs that had the aptamer placed such a way that there were no longer space for a static stem in the switching area, as the other labs allowed for.


I submitted sequences from earlier winners that did have a static stem, but just with with the sequence from the static stem part excluded. I expected the miniaturized designs to take a score hit. They all did, but one. So generally the static stem did seem to have a function. But that one exception have had me mystified since. I wrote about this design.


I can now explain why this particular design managed to escape the score hit dealt by the missing static stem. 

The static stem deletion caused a style change in the resulting design. Its arc plot is of the spiral kind. I think the spiral designs have a potential for reaching a far higher fold change than the circularized design style. 

Spiral Arc Plot Needle in a circle Arc Plot Haystack


I was watching past lab winners in jandersonlee’s arc plot tool when I stumbled over this arc plot. It was a spiral. I looked up the design and realized that this was the design that had me baffeled from my #StaticStemDeletion experiment. It is from the one design from my static stem deletion experiments that had a better fold change than the original winning design that had the static stem.





I toggled the design from state to state and indeed this design a microspiral - a miniaturized spiral design. A shorter train of stems sliding. Watch how it slides. Just like the many recent spiral designs in the open lab.


https://eternagame.org/game/browse/6369346/?filter1=Id&filter1_arg2=6453151&filter1_arg1=6453151



Spiral designs with special switch graph signature



In addition to the spiral arc plot, the design had a curious switch graph.



https://s3.amazonaws.com/eterna/labs/histograms_R101_ng/6453151.png



I am wondering if the two curves not meeting at the right end of the graph image, means that the design has not gone through its full switch potential within the time limit.


I have found other designs with spiral arc plots that have the same switch graph signature that shares traits with my #StaticStemDeletion - JL SNG1 3.00 18 - variant 3 design.


Just to mention Zama's Tryp B SS (MGA) ZZ-1-18 and Jieux's Comedy 1 #all3 #staticstem from the lightning round 1 were also spirals, show the same switch graph behaviour.


Image borrowed from the newspost News on the Fast Track Experiments


It’s the same case for the switch graph of ViennaUTC's big spiral that gets the best fold change of all the small loops labs from Round 101.


https://s3.amazonaws.com/eterna/labs/histograms_R101_ng/6438980.png

https://eternagame.org/game/browse/6369383/?filter1=Id&filter1_arg2=6438980&filter1_arg1=6438980


It is possible to find spirals that don’t show this exact switch graph pattern. Like this switch graph for the spiral design by ViennaUTC from the partner lab. It doesn't have this switch graph curves as the other spirals. Best fold change of all the 8 Small Loop labs. Eg this one:


https://s3.amazonaws.com/eterna/labs/histograms_R101_ng/6433626.png

https://eternagame.org/game/browse/6369377/?filter1=Id&filter1_arg2=6433626&filter1_arg1=6433626


But I find it fascinating that the designs with spiral arc plots also seems so show early tendencies of trending toward getting distinct switch graph curves. The designs with spiral arc plot are different to the designs with circularized arc plots. 
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
The round 4 batch from the lightning round had a bunch of working spirals along, in particular in the Tryptophan B Same State (Spinach) lab. 

Many of the spiral designs (green boxes) had switch graphs where the blue and red line were apart and don't meet at the end (to the right). Just as the switch graphs I pointed out for earlier spiral lab designs. 



I have added arc plot type to each design. Plus the #SB and #BS reveals the orientation of the spinach aptamer. B stands for big (longest side of the aptamer) and S stands for small (shortest side of the aptamer). That way I can use the same abbreviation for different aptamers. I use these hashtags on my lab designs, as for being able to group the designs after types. 

So far there have been mainly counterclockwise spirals for the lightning round. 

The patterns that seems to be there so far is that the Tryptophan B Same State (Spinach) with the best fold change and wide switch graph have in common, are that they are spiral designs + they use a selfturnoff binding for the tryptophan aptamer. Plus the two designs with the best fold change (27.7 and 19.5) + wide switch graph have in common, compared to the other designs, are that they have static stems at one end of both aptamers.

Arguably some of the Tryptophan A Same State (Spinach) designs employed the same strategies, but with less luck. The one with the best fold change (but also the lowest response) did both spiral and use tryptophan aptamer selfturnoff. (Jieux's Tidy Monster design)


Advice for round 5

If you are into spirals as am I, make sure you try out both clockwise and counterclockwise spirals. Plus try these out in combination with different aptamer orientation. That way we make better sure that we hit on what works best. 

Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
You said above: Many of the spiral designs (green boxes) had switch graphs where the blue and red line were apart and don't meet at the end (to the right). Just as the switch graphs I pointed out for earlier spiral lab designs.  My question is- would the goal be for them to meet on the right?
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
From what I understand, if the designs are tested at a longer time they may. I think Omei and others can explain the details better. From what I see the designs aren't finished switching. They are slow starters and slow finishers. :) Compared to the more typical winners in RNA origami solve style designs with more circularized arc plots. 

Zama also sent me a question in relation to my image in the above post: 

Hi Eli, I'm not seeing the clockwise in this design????




Ok, I think I know what happened. I saw two spirals and since I have a habit of taking one road if I can, I just continued outward counterclockwise after I reached the middle. Normally I go from outside and in when I count what orientation it is.

Zama is correct. Both these spirals are clockwise going outside in. 


Another thing, is that what spiral is in native and in states are not always the same way. Normally I count spiral orientation from states. Now I can't remember any design in particular, but I know I have seen designs where the spiral went one orientation in states and the opposite in natural.

Can you guys find examples?

(Edited)
Photo of Benbennett1

Benbennett1

  • 24 Posts
  • 3 Reply Likes
those arc plots are messy with faint lines. not good.
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Lightning round voting strategy proposal


I have a proposal for voting strategy for Puzzles for lightning round 6, for those of you who are into spirals like me. 

There are main 4 types of spirals:

1) Clockwise spiral (#CW) and big MGA aptamer sequence before the short MGA aptamer sequence (#BS)
2) Clockwise spiral (#CW) and short MGA aptamer sequence before the big MGA aptamer sequence (#SB)
3) Counterclockwise spiral (#CCW) and big MGA aptamer sequence before the short MGA aptamer sequence (#BS)
4) Counterclockwise spiral (#CCW) and short MGA aptamer sequence before the big MGA aptamer sequence (#SB)

While I try make a bunch of spirals in each of these 4 categories, I am not asking you to vote for my spirals. Pick  whatever spirals you like best. What I'm asking is when you cast your vote for spiral designs, that you try pick one spiral in each of these 4 categories. 

The reason I ask is that I hope is that we get a complete or near complete set of all 4 spiral types through the voting process. This may help start get an idea what orientation for spirals and MGA aptamers that may be best in these two labs. Which again may help us on what future lab rounds want. 

Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Another wish if you use hashtags to signal spirals. I would like to have the spiral orientation first (#CCW or #CW) and then the MGA aptamer orientation (#SB or #BS) after. Then they can be searched out at the same time and isolated together. So eg. #CCW #SB not #SB #CCW.

If you manage to make a double spiral as described in the next post below, I would be happy if you stick a #double after the other two hashtags. Like #CCW #SB #double

Or if it is a single spiral #CCW #SB #single

Again. Don't go back and change your previous designs. Just know that adding these hashtags in a fairly similar way will make it easier for us to analyse the data afterwards and drag useful trends faster. 
Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
Reminder: Eli is reading spiral direction (counterclockwise vs. clockwise) from the outside of the circle inward. I was reading it from the inside out, which would make it just the opposite. 
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Zama showed me an example yesterday. Here it comes. 

zama: @eli, the counterclockwise design you have in your new Google Doc- looks clockwise to me?

zama: this looks counterclockwise to me


eli: The image you show above is clockwise. I count from the outside start of the circle.



Google doc with examples of different spiral types. 

Spiral and MGA aptamer orientation demo


Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Zama brought up something today that I think will be a helpful perspective on spirals. Hereby I bring part of our discussion. 

zama: Many of our spirals resemble Fermat's Spirals. I'm curious if there is a way to gauge how close we can get to them?



eli: I think it has to with how you fill the loops out inbetween the sliding stems that are creating the spiral.

If you make an even number of loop bases on both sides, you will get a straight stem. I have a puzzle demonstrating.

Or rather I have 3 puzzles, that may get you a sense of it. https://eternagame.org/web/puzzle/9023368/


https://eternagame.org/web/puzzle/9024748/


https://eternagame.org/web/puzzle/9007424/

zama: @Thanks- and here I've been trying to avoid doing player puzzles lately- lol!

eli: In fibonacci spirals the spiral is growing, it isn't equally close all the way. To create a growing spiral you will need to add more single bases in loops on both sides in a growing pattern.

Hehe

you can usually count on mine having something to do with lab.

Unless cynwulf has got me curious on something. :)

zama: The Fermat Spiral doesn't grow like the Fibonacci- why I thought ours looked more like a Fermat

eli: Ah, yes, I see I misunderstood

Image result for fermat spirals
https://i.pinimg.com/236x/fe/90/ce/fe90cea2119fc32c69aeb6fcfece298e--alchemy-spirals.jpg

Ok, then you should be perfectly fine with even side loops on both sides of the sliding stems

as this puzzle


https://eternagame.org/web/puzzle/9023368/

Actually the sides in the above image seems to get smaller (edited)

zama: Do you think the Fermat could be duplicated in design?

eli: I think it already has

That Pi design, as I recall it has the fermat patterns as what you showed

zama: 

I wondering if the closer a design is to matching the Fermat equation the better the score??

eli: GCACCAGGUACGGAUACCAGACGUUGCCAAACAGGGUGACAUGAGGAUCACCCAUGUACUGUCCCUUGGCAGCCGUACCUGGUGC

That is a fine hypothesis



Now the spiral doesn't go the whole way through both of them. But there is a black strong line suggesting a bond will form and connect the two spirals. (with light green highlight)

Perhaps easier to see now:



Link to Pi's design: https://eternagame.org/game/browse/7559902/?filter1_arg1=7612876&filter1=Id&filter1_arg2=761...

zama: The design of yours that I posted above looks closer to me.

eli: Can you give me a link to it?

zama: It's from the google doc your working on. https://eternagame.org/game/browse/8787266/?filter1=Id&filter1_arg2=9037947&filter1_arg1=903...

eli: Mine only gets one full spiral through



Try play with the chain marker in the arc plot tool. First unmark, then choose chain. You can shift color by holding down shift

What I mean your fermat spiral image has two intertwined spirals both originating from the center of the sequence.

That is almost what Pi's design does

zama: Ok, it looks more like the Fermat image you posted.

eli: Yup. single fermat

I like this fermat illustration as the color contrast hightlights the inverted mirroring.
Fermats Spiral

found it here: https://codea.io/talk/discussion/1770/fermats-spiral-another-experiment-with-large-images-meshes-and...

I see that the spiral arc plot you posted next to your fermat image is single spiral. But your fermat image is double spiral, just as my fermat image is single spiral. Both kind of arc plots are there. My arc plot represents the single fermat image and Pi's arc plot represent the two nested fermat spirals. (edited)

So really when we vote for spirals we should vote for 8 different types of designs. :)

4 single fermat spiral types + 4 double fermat spiral types


Recipe for double spirals

Ok, I'm not sure the double spirals are possible in same state labs. Pi's design is an exclusion lab. And there the aptamers have to counter each other. One be on in one state and another be on in another state. 

Actually there are. They just look a bit different to Pi's exclusion double spiral. They instead get a characteristic snail shape. 

Here is a good example from a previous post



It is from Dl2007's design with fold ratio 1.13 (from Lightning round 4 results).



Watching Dl2007's design, I think the road to making double spirals is to focus on one of the aptamers. Then to pick two spots in this aptamer that can both pair with themselves in one state (1) and then have these two spots bind two places else in state 2, and have those two new partner spots in state 2 perhaps bind somewhere in state 1. 

Kind of like this: 



While we haven't seen high scores for double spiral designs yet, I would like to see them getting made and also voted for just as the same 4 types that I wish to see single spirals for. 

(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 977 Posts
  • 307 Reply Likes
Player recommendations for the current lightning round (round 5)

@jandersonlee has added batch processing capabilities to his arcplot server, so it has now become realistic to process and evaluate large batches of designs. I've talked it over with some players, and we concur that it is time we start publishing some results to help collaboratively improve players' ability to evaluate designs.

The process will continue to evolve, but for this round (voting closing Wednesday PM), I am inviting all players (whether or not you are using arcplot) to post your recommendations for the two labs here.  There are no strict rules for this, but I'll suggest the following guidelines:
  • Limit your recommendations to no more than 10 per puzzle.
  • Include your rationale for your choices, so other players can learn from your thinking. Depending on how you go about determining your recommendations, this might be a single sentence for each design or a general description of your selection process.
  • Feel free to include a link or links to supporting material and/or to the designs themselves.
  • Don't get hung up on precisely following these guidelines.
If for any reason you would like to publish your recommendations anonymously, PM them to me and I will post them here for you.
Photo of jandersonlee

jandersonlee

  • 554 Posts
  • 129 Reply Likes
Here are some Theophylline A Same State https://eternagame.org/game/browse/8787270/ designs that interest me this round:

seq,minAoff,minAon,minAx,maxAx,minRoff,minRon,minRx,maxRx,mfe1,mfe2,dFE,bonus,same,pp1,pp2,d1,d2
UAAGGUGAGGCGCCCAGCCCGACGGUUGAUACCAGUAGCGCAGCCUACCCUUGGCAGCAGUCCGGUAACGAAUGGCUGGGCGCCC,0.007,0.785,30.823,112.792,0.007,0.777,1.012,106.869,-37.500,-38.900,1.40,-4,1,0.992726,0.777362,0.488748,0.422383
UUAUUAUUAAGACAGUCUGAGCCGACGGAUACCAGAGACAAUAGUCUCCCUUGGCAGCUGGUAACGAAUGCUCAGGCUGACAAUU,0.017,0.903,1.815,52.704,0.017,0.876,1.000,52.539,-28.400,-29.800,1.40,-4,1,0.983335,0.875562,0.478785,0.436298
GUCAGUAGAAAGACUAACUGGCCGACAGAUACCAGCCAGUUCGCUGGCCCUUGGCAGCUGGUAACGAAUGCCAGGUCCUACUGAC,0.003,0.643,33.213,194.814,0.003,0.637,2.922,193.952,-33.000,-34.000,1.00,-4,1,0.996716,0.636938,0.470543,0.378125
CGCUGGUCGGACAGGUAACGAAUGACAGAUACCAGCUACGAAAGUAGCCCUUGGCAGCUGUCCGACUGUAAUAAUAGCGAAUUAU,0.005,0.716,1.012,155.224,0.004,0.588,154.439,154.504,-27.600,-28.700,1.10,-4,1,0.996193,0.587949,0.484057,0.356055
UUAAUUAUUAGUAGGACCUCACCGACAGAUACCAGCCAGUUGUCUGGCCCUUGGCAGCUGGUAACGAAUGUGAGGUCCUACAAUU,0.006,0.764,71.682,129.152,0.006,0.757,1.009,128.564,-37.100,-38.100,1.00,-4,1,0.994111,0.757111,0.472230,0.399191
CGCCAGUAACGGUUAAAGGCACCGACUGAUACCAGUGUCGAUAGACACCCUUGGCAGCAGGUAACGAAUGUGCCAAUUACUGGCG,0.010,0.847,1.062,81.533,0.010,0.597,52.088,81.203,-31.800,-32.200,0.40,-4,1,0.989887,0.597087,0.490786,0.358677
CUGAGCAUAAUCAGCAGCUCACCGACUGAUACCAGCCAGGCCGCUGGCCCUUGGCAGCGGGUAACGAAUGUGAGCUGCUGCUCAG,0.006,0.747,20.410,117.373,0.006,0.680,1.005,115.914,-39.000,-40.000,1.00,-4,1,0.994133,0.680065,0.491121,0.405857
CUGAGCAGCAUCAAUAGCUCACCGACUGAUACCAGCCAGGCCGCUGGCCCUUGGCAGCGGGUAACGAAUGUGAGCUGCUGCUCAG,0.006,0.747,19.682,117.471,0.006,0.680,1.006,116.006,-39.000,-40.000,1.00,-4,1,0.994139,0.679913,0.492882,0.407541
AAGUGGCUAACCGGUAACGAAUGUAACGAUACCAGUUCUGAAUUGGGCCCUUGGCAGCGUUACCGACGGUUGACUUAAGCCACUU,0.004,0.617,107.908,165.667,0.006,0.593,0.771,106.290,-29.000,-29.100,0.10,-4,1,0.994199,0.592568,0.490879,0.415939

All have static necks, and good metrics and the MFE in state 2 has both the reporter and aptamer sites. Some are spirals, some are not. Past labs (R101, R107) indicate that designs can perform well with these metrics:

like: maxAx>20,maxRx>50,minAon>50%,minRon>50%,d1<0.5,d2<0.5,dFE<1.5

I've also made some mods to some of these to fill in my last few slots.

Photo of spvincent

spvincent

  • 49 Posts
  • 10 Reply Likes
I find there are more submissions in each puzzle than can reasonably be looked at so my approach tends to be a quick eyeballing.

I usually just look at all the submissions for a particular individual as this makes things more tractable: and will mostly use Vienna2 and the old browser continuously pressing d to flip through the structures. I keep meaning to look at the arc plot tool but have yet to get around to it.

What I look for is something I think of as cleanliness of design (for both states). It's a  little hard to define but it tends to mean a pleasing-looking geometric structure with an absence of too many kinks, small bulges and other oddities. Also the two structures must look sufficiently different that there's a reasonable chance of good switching. Other considerations would be a reasonable balance in the nucleotide composition (i.e. more or less a quarter each of AUCG) and retaining the general structure when switching to Vienna or Nupack.

I try and only submit solution per designer and don't look at the number of votes already cast (this might be a mistake as there's a tendency to end up with a lot of solutions with only one vote)
Photo of Gerry Smith

Gerry Smith

  • 68 Posts
  • 35 Reply Likes
Yes, to harness diversity of informed opinions, voting twice makes sense (a little more work).  The first time to get a list of designs with at least one vote.  And the second time (later), screening for designs with 1 or more votes and then changing your votes to those within that group.   Your approach sounds thoughtful and different enough so it could add even more value in re-voting a second time....
Photo of jandersonlee

jandersonlee

  • 554 Posts
  • 129 Reply Likes
For Tryptophan A Same State, these seem interesting to me:

seq, minAoff, minAon, minAx, maxAx, minRoff, minRon, minRx, maxRx, mfe1, mfe2, dFE, bonus, same, pp1, pp2, d1, d2
GCCUGAGAACGGUCCAAAUAACUCCUCCGACGAGGACCGGUACGGCCGCCACUCGGUAACGAAUGAGGAGUGGCGGAUCUCAGGC, 0.004, 0.703, 146.611, 182.506, 0.004, 0.702, 158.660, 182.411, -39.200, -39.200, 0.00, -4, 1, 0.996151, 0.701914, 0.008729, 0.034545
GCCUGAGAUCGGUCCAAGAGGUAACGAAUGCGAGGACCGGUACGGCCGCCACUCGCCGACUCUUGAUAAAGAUGGCGGCUCAGGC, 0.006, 0.774, 120.303, 139.307, 0.006, 0.707, 111.855, 139.204, -33.900, -35.100, 1.20, -4, 1, 0.994491, 0.706812, 0.234304, 0.209413
UCUGCAAACUAUGAGUGGCCGACGAACCGACGAGGACCGGUACGGCCGCCACUCGAAGGUUUGGUAACGAAUGCCACAAAGCAGA, 0.002, 0.594, 248.497, 249.017, 0.002, 0.556, 248.846, 248.855, -31.000, -31.700, 0.70, -4, 1, 0.997767, 0.555674, 0.431786, 0.360016
UCUGCUAACUAUGAGUGGCCGACGAACCGACGAGGACCGGUACGGCCGCCACUCGAAGGUUUGGUAACGAAUGCCACAAAGCAGA, 0.007, 0.803, 121.408, 121.482, 0.006, 0.750, 121.321, 121.329, -32.000, -33.300, 1.30, -4, 1, 0.993820, 0.749811, 0.412265, 0.353036
GUGAUCCACUAUGAGUGGCCGACGAAUCGACGAGGACCGGUACGGCCGCCACUCGAAGGUUUGGUAACGAAUGCCACAGGAUUAC, 0.006, 0.800, 114.672, 123.456, 0.006, 0.737, 123.360, 123.395, -30.100, -31.300, 1.20, -4, 1, 0.994026, 0.737162, 0.386218, 0.325203
GUGAUCCUACCUAUGAGUGACCGACACUGACGAGGACCGGUACGGCCGCCACUCGUAGGUGGUAACGAAUGUUAUUCAGGAUUAC, 0.013, 0.892, 23.948, 67.111, 0.012, 0.798, 66.968, 67.068, -30.700, -31.700, 1.00, -4, 1, 0.988102, 0.797973, 0.379268, 0.329051
GCUCAUUUUACGAGAGGCCGACGUGACUGACGAGGACCGGUACGGCCGCCACUCGUAUUUCAUGGUAACGAAUGCCAUUCUGAGC, 0.004, 0.702, 171.650, 182.943, 0.003, 0.522, 182.791, 182.796, -27.700, -28.700, 1.00, -4, 1, 0.997145, 0.521883, 0.438209, 0.367725
AAAGAAAAUACUCUUUUACGGGCGUCCGACCGAGGACCGGUACGGCCGCCACUCGGGUAACGAAUGACGGGAUCGUAAAAGAGAA, 0.012, 0.881, 73.944, 74.024, 0.010, 0.744, 73.597, 73.979, -32.100, -32.700, 0.60, -4, 1, 0.989889, 0.744144, 0.527156, 0.468019
ACGCUCCAAUUAUAACGGCCGACACGUUUACGAGGACCGGUACGGCCGCCACUCGAUCGUGGUAACGAAUGCCGAAAAGGAGCGA, 0.016, 0.910, 55.614, 56.246, 0.013, 0.756, 50.148, 56.154, -29.000, -30.400, 1.40, -4, 1, 0.986535, 0.756111, 0.340554, 0.284054
CCUCCUAUAGGAUGAUAUCGAAUCCGCCGACGAGGACCGGUACGGCCGCCACUCGGUAACGAAUGCGGCGACAUCCUGUAGGAGG, 0.011, 0.874, 72.217, 78.184, 0.010, 0.711, 68.434, 78.138, -41.100, -42.500, 1.40, -4, 1, 0.989604, 0.711440, 0.374165, 0.285274

Once again, all have relatively clean, symmetrical dot-plots, a strong, static neck, the aptamer and reporter both show in MFE for state 2, and the metrics are similar to those of prior lab winning designs (R101, R107) except for the seventh one whose d1 is just slightly high. 
like: maxAx>20,maxRx>50,minAon>50%,minRon>50%,d1<0.5,d2<0.5,dFE<1.5
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Here is a list of designs that I like for the two labs that are open for voting. It is my document with sets of different spirals. I have added a few extra designs for each the two labs and explained why I like them. It's still a work in progress, but here is what I have so far:

Spiral and MGA aptamer orientation demo


Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
https://imgur.com/a/llAfHod

If you average the arc plot pairing percentages for non-static pairs you can get a rough approximation of the experimental Fold Ratio. Perhaps this could be built into the arc plot generator as a way of averaging out the ratios figures given by the generator.

Obviously it's not 100% accurate because the real world testing concentration is over a range, and my example doesn't look at all bonding pairs, but I think it gives a better overall picture than the pairing ratios individually
(Edited)
Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
Very interesting! In the meantime, now that the arcplot can also output data in .csv format, a column to do this could be added to a spreadsheet.  Just tried it and I guess all the information you're using isn't in the .csv.
(Edited)
Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
I have been playing with your formula all morning and find that in some cases it comes amazingly close to results but in other cases, it is off considerably- like Jieux's high-scoring Comedy 1 in Round 1. In any case, it made me look a lot closer at how the various numbers impact the results- thank you very much!
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
Hi Zama, the way I did it before wouldn't apply to exclusion puzzles, because what I'm doing is averaging out the results for the probability of one specific structure forming.
So what the Folding Ratio from the real life experimental results tells us is the folding ratio of the MGA loop forming in one state and not the other, it doesn't demonstrate anything else, so if you were to apply what I'm doing to Jieux's puzzle, you would look at non-static MGA bonds and apply the following, regardless of any other structure forming.
I haven't tested this hypothesis too much, but for the few things I have it's worked out well, I'll work on my theory some more




(Edited)
Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
Yes, thank you for the explanation and visual. I knew the off would be different, but now I see where you're getting your numbers. 
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
Here's my predictions for the Round 5 results for anyone who's interested:

Theophylline A Same State (Spinach):

Astros-Modly-mod3 (Astromon) 29.24

JanderMod 10 #all3 #staticstem - Jieux - Theophylline A Same State (Spinach) (Jieux) 24.81

TheoASS-SPIN-68 (Poll na gColm) 1.62

Theophylline A same Spinach 62 (dl2007) 14.45

JR_TheoASS(Spin)_Sub00102 (JR) 40.67

 

Theophylline B Same State (Spinach):

Astros-thepienspinack (Astromon) 9.77

Theophylline B same Spinach 69 (dl2007) 0.66

Thepienspinack mod A #spiral #mirrored_arcplo (Omei) 1.40

#Outsideaptamerturnoff 2 (Eli Fisker) 1.54

JRmod 10 #all3 #proximitylocked #staticstem - Jieux - Theophylline B Same State (Spinach) (Jieux) 1.0

JR_TheoBSS(Spin)_Sub005 (JR) 8.87




Photo of jandersonlee

jandersonlee

  • 554 Posts
  • 129 Reply Likes
finding some bugs in some of the metrics code, so my recommendations may change.
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
I have used jandersonlee's arc plot tool to filter through all the Theophylline A Same State (MGA) designs submitted so far and used filtering to get rid of most of the designs. Then I got the tool spitting out arc plots and dumped them in a doc. Here are the resulting 144 arc plots. I have left the result of the full search at bottom of the doc. 

Theophylline A Same State (MGA) Arc Plots

Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Multistate arcplot

I have an idea for multistate arc plot. (2+ states) 

I will use a 3 state spiral puzzle I have made where all 3 states connectedly make a spiral - for illustration. 



What I imagine is the arc plot as an opened book. Top page is the top arcplot for state 1. Bottom page is the bottom arc plot half for state 2. 



Image by Katrine_S

Turn to next page and one could view an arc plot for state 2 and 3. It could also be 1 and 3. Or one could click an arrow to one of the sides for the page with arc plot for state 1 or 2, so one could swipe out one arc plot state for the next states arc plot.





Turn yet a page and one could view state 1 and 3 together. 




Imaginary Arc plot tool with 3 states




(Edited)
Photo of Benbennett1

Benbennett1

  • 24 Posts
  • 3 Reply Likes
spirals have nothing to do with anything. focus on the faint (possible but unlikely) bonds
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Here is a document with filtered Theophylline B Same State (MGA) designs: 

Theophylline B Same State (MGA) Arc Plots


Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
I filtered the so far submitted Tetracycline B Same State (Spinach) designs. Here is a document with arc plots of the resulting designs. 

Tetracycline B Same State (Spinach) arcplots

Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
Thank you, Eli! The multi-looped tetracycline aptamer with hairpin sure does mix-up the look of things.
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Np, Zama! I was happy to see that there were even a bunch of spirals among. 

I have managed to find, mood or make 3 of 4 spiral types. #cw #bs, #cw #sb and #ccw #sb. I haven't managed to find or make #ccw #bs yet. 
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Here is an additional document with a filtered set of designs from the FMN A Exclusion lab. I added stronger filter conditions as I ended up with more than 200 designs after my first filtering. 

FMN A Exclusion 
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Here is some analysis in relation to our new results for lightning round 5 that got shared in the news post Lightning round 5 results.

Omei was wondering about why the Theophylline B Same State (Spinach) lab went bust, while the Theophylline A Same State (Spinach) lab went great. 

I think I have an explanation. 


A or B puzzle type? 

A pattern that has been there from our recent lab with a reporter against an aptamer is the following:

When there are two partner labs, where the only difference is that the order of the reporter and the aptamer have position swapped for each other, then one of these partner labs tend to do a lot better than the other. There is an optimal order of aptamer and reporter in relation to each other. 

In the R107 lab Single-input switches, revisited we had a lab round that looked at the MS2 reporter against a bunch of aptamers that were mostly new to us.

The aptamers were Tryptophan, Theophylline and Argenine. That lab too introduced the puzzle type naming A or B - in relation to if the MS2 sat outside of the aptamer. (A type) or if the MS2 sat between in between a split version of the aptamer. 

Earlier we also had the R101 lab FMN/MS2 Riboswitch Structure. Those puzzle types weren't named A and B type. But what pattern has showed itself in relation to MS2 so far is that the B puzzle type generally has performed better than the A type. The pattern has been present from the earliest FMN/MS2 switches. 

So Aptamer-MS2-Aptamer labs tends to go better than MS2-Aptamer-Aptamer. 


Explanation to the image

The numbers 1 or 2 over the middle aptamer section signify if the aptamer is in one whole piece or if it is split. 

The behaviour column where I have put MS2 equivalent to different aptamers, I'm basically stating which aptamer that takes the strongest aptamer spot, where MS2 would normally like to be if it was a part of a riboswitch. 

                 




Relative strength of aptamers in relation to each other

However now we are trying a bunch of relatively new aptamers to us, plus some new reporters. For these new aptamers I have mentioned that we still don't know which of them are strongest. As opposed to eg MS2 and FMN. In past labs MS2 has been pretty strong and rather stuborn, so that it took a good bunch of bases to make it turnoff. 

I have expected the stronger aptamer/reporter to take the spot of MS2 - in the middle between the sequences of the other aptamer. 


Future prediction 

I will take a stab at future prediction for the fate of a couple of the labs that we don't have results on yet. I will base my guess on the result from their partner lab. The lab that has the same flourescent aptamer, but is of the opposite puzzle type. (A versus B type)

  • Since Tryptophan B SS (MGA) went well, I guess that Tryptophan A SS (MGA) will go less well
  • Since Theo B SS (MGA) went bad, I guess that Theo A SS (MGA) will go well
  • Since FMN B Exclusion (MGA) went well, I guess that FMN A Exclusion (MGA) will go less well

If we are to do more lightning round labs before the full lab round, then I propose Theophylline A Same State (MGA) as candidate as I expect it to do well. 



Request of extra lab puzzles

The Tetracycline Same State B (MGA) lab went bad. (Tetracycline-MGA-Tetracycline) But we never had its partner lab Tetracycline Same State B (MGA). (MGA-Tetracycline-MGA)

Provided that it is possible to make the partner tetracycline lab, I excect based on the result so far, that it should do better than the one we have done.

Basically I wish that we have a full set of partner labs for all the labs we have been working with so far. 












(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
I did a summary of the lab with the two good designs in the lightning round 5 labs. Theophylline A Same State (Spinach) https://eternagame.org/game-legacy/browse/8789144/

I have noted that the two great designs, the one by Astromon and the one by JR both follow previous lab trends. 

JR's good design is of the circularized arc plot kind - in this case looking like a clown mouth in natural view.  



It is if the symmetric RNA origami style - making a switching movement typical of the majority of past winners. Plus both aptamers have static ends. Weird enough this circularized design has a similar switch graph as the spirals generally seem to have. 



Astromon's good design is of the spiralized arc plot kind. It has an aptamerselfturnoff for the theophylline aptamer. Plus just as the 2 best designs in Tryptophan B Same state Spinach both of it's aptamers have one static end. 





Theophylline A Same State (Spinach) summary

+ Astromon (9019376) #Spiral #ccw #bs #aptamerselfturnoff #two static aptamer ends
- Jieux (8895380) #spiral #ccw #SB
- Poll na gColm (9026438) #spiral #ccw #sb 
- Dl2007 (8978861) #spiral #CW #BS
+ JR (8803108) #BS #symmetric Circularized arc plot #two static aptamer ends


Word explanation

#CCW - counterclockwise spiral
#CW - clockwise spiral
#BS - big side of aptamer first, small side later (for spinach or MGA)
#SB - small side of the aptamer first, big side later (for spinach or MGA)
+/- - weather the design did well or not

Photo of Benbennett1

Benbennett1

  • 24 Posts
  • 3 Reply Likes
eli, i need to speak with you
Photo of DigitalEmbrace

DigitalEmbrace

  • 43 Posts
  • 26 Reply Likes
I have a couple notes to add. Neither of these two winners forms the same shape in all three engines, whereas I've noticed our best winners hold their shape fairly consistently across all three engines. I've noticed this is fairly rare in my limited experience.

All our Lighting Round winners have at least one loop in state 1. Even if the loop is small, perhaps the unpaired bases provide a weak spot where the molecule can separate to fold into state 2.

And static stems work once again. I'm guessing these add stability to the shape and provide a foundation for each aptamer so that the aptamers don't have to form completely out of nowhere.

Sorry if I'm repeating the obvious. Feel free to fill me in!
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Benbennett1, do speak. 

DigitalEmbrace, thx for your notes. 

"And static stems work once again. I'm guessing these add stability to the shape and provide a foundation for each aptamer so that the aptamers don't have to form completely out of nowhere."

I think this is exactly why. 

Keep an eye for a continuation of your 1 loop in state 1 idea. Do this loop turn up somewhere specific? What I'm wondering is if there is any pattern?


Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
A and B type lab predictions holds up


Recently I made a prediction for the few labs that we still hadn't done lightning rounds in from the Lighting Up Dark Cell's round. 

Now we have gotten results back from two of these labs where I made guesses. Tryptophan A Same State (MGA) and Theophylline A Same State (MGA) 

  • Theophylline A MGA had good difference between the blue and red curves in several switch graphs.
  • Tryptophan A MGA had only really minor difference between the blue and red curves in some of the switch graphs.


                 


Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Reading the new switch graphs


While the scoring scheme for the new switch graphs is still in the making and things as such are not set in stone yet, there are still things that can help us with deciphering the switch graphs. 

Omei was answering switch graph reading questions.   

                


Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 977 Posts
  • 307 Reply Likes

Looking over the lightning round results, I noticed that on the whole, we have done considerably better with the Spinach aptamer than the MGA one. So I looked over some of the better MGA designs, like this one from the first round (Jieux's Comedy 1 #all3) to see if there was anything in common among those that did switch. 

 

The first three I found all shared the characteristic of having an AU pair next to the larger of the aptamer loops

A quick check showed that this particular choice of pairs was not that common, and I wondered if there might be something in the scientific literature that could account for how an AU pair here could influence the binding. I found three experimental papers about the aptamer.  It turns out that the bulk of the experimental data has been done on this hairpin sequence, with minor variations. 


(Note that the base pair 11-22 corresponds to the highlighted pair above.)

The three dimensional structure of this aptamer binding to the malachite green molecule has been determined, and it is very unusual. The bound aptamer is stabilized by two base triples and one base quadruple. The first three panes of the diagram below mark the bases involved in these structures.


What is happening is that the RNA backbone at base 25 actual makes a U-turn, allowing base 26 to reinforce the pair U10-A23 and 27 to reinforce the pair C10-G23. Here's the 2D structure of the 3 reinforcing structures. (This figure comes from a paper that used a triloop hairpin instead of a quad loop , so the base numbers over 19 are shifted by one.)


Furthermore, the AUA triple has been shown to be very important for the stability of the binding pocket. Reducing the triple to a normal Watcon-Crick pair by mutating base A26 (A27) reduces the binding energy of the aptamer by 2.5 to 3 kcal, essentially eliminating its affinity.

Unfortunately, the question of most importance to us (should be always design with the AU pairing at this position, or are others just as good?) isn't specifically addressed in the scientific literature. There is a possibility that pairs other than the AU can form the same, or similar, triples. But the lightning rounds have given us results on 42 MGA designs that we can compare. Those results suggest that the AU pair is an especially good choice. Because there are differences among the rounds, there doesn't seem to be a unique way to make the comparison, but here is an obvious one. 

Of the 42 MGA designs, only seven (17%) have used an AU pair in the same orientation as above.  But of the six best fold ratios (> 2.6), four (67%) have used the AU pair.

I intend to follow up on this over the next day or two, but I wanted to post this much now. The current lightning round is using MGA. and it seems that the choice of bases at this position should be a significant factor in both designing and voting.
Photo of spvincent

spvincent

  • 49 Posts
  • 10 Reply Likes
This illustrates what seems to be a limitation in eterna: the inability of the engines to look beyond standard Watson-Crick base pairing and examine all the more exotic forms of hydrogen bonding that you might see in a full 3D structure (Hoogsteen base pairing, triple and quadruple base pairing, bonding to the ribose, etc. ). Not suggesting I have an answer for this but half the time the engines can't even agree on the secondary structure so the prospect of evaluating the full tertiary structure is remote indeed.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 977 Posts
  • 307 Reply Likes
Following up on the above, I categorized each of the designs tested so far that used the MGA aptamer by the next-to-closing base pairs, i,e, 11 and 22 in the above screen shots.  But before showing that table, I want to clarify what I mean by an AU pair vs a UA pair.

The pair I am always referring to is the next-to-closing pair of the bigger aptamer loop -- bases 10 and 70 on the left and bases 59 and 27 on the right. (Regardless of the orientation of the aptamer, the stem base next to the closing G will always have a number one less than the G and the stem base next to the closing C will have a number one more than the C .) When I categorise a pair, I will put the base next to the G first. Thus, the next-to-closing pair in the design on the left is AU. On the right, it is UA.

For the purpose of calculating a summary statistic for a group of designs, one can't meaningfully average fold ratios. But the fold ratio can be converted to an energy value (called ddG) by taking its logarithm, and it is appropriate to average energy values.

So here's the average energy difference between states 1 and 2, grouped by next-to-closing pairs of the big end of the MGA aptamer. (I have omitted the UG and GU pairs because there was only one instance of each, and the values were unexceptional.)

This indicates that in the designs tested so far, the AU pair retains its advantage over others when considering all the designs, good or bad. As far as interpreting the significance of the ddG values, the difference between the ddG values for AU and UA (0.7) corresponds to slightly more than a doubling of the fold change.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 977 Posts
  • 307 Reply Likes
In a comment to the latest news post, spvincent asked "Is the MGA loop sequence cast in stone or is there any flexibility that could be exploited? Make binding a little weaker perhaps." I'm going to respond here because it is easier to include images.

The short answer is yes, this question has been studied. The following table is from the journal article Recognition of Planar and Nonplanar Ligands in the Malachite Green–RNA Aptamer Complex.

with the base numbering shown here:

The first column ("Wild type") refers to the sequence shown in the second image. The right-most column shows how much the given mutation weakens the binding energy.

For the record, this experimental data was determined using not malachite green as the molecule, but a closely related one, tetramethylrosamine (TMR) for technical details. The article discusses why this was done and why it shouldn't make much difference, but I didn't even attempt to understand it.


Photo of JR

JR

  • 241 Posts
  • 20 Reply Likes
Article's results were not derived from a "switch" environment ( as far as I can tell ) so results between it and us may be different so I wouldn't follow the article's recipe to a tee. Another something interesting comparison to study when we have the results at our disposal.
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
                                                           THE CASE FOR SPIRALS

Overview

  • So how did the spirals do?
  • Why do spirals work?
  • Spirals and special switch graphs
  • Spirals and aptamer self turnoffs
  • Static stem deletion and spirals
  • Spirals and static aptamer ends
  • What is the benefit of spirals?
  • Spirals and circularized winners and reuse of switching bases
  • Spirals are the Schrodinger's cat of RNA
  • Spirals and chain reaction
  • Where have the spirals shown up?
  • Spirals as top dog in labs that were hard to solve.
  • Spirals and fold change


So how did the spirals do?

We have now had 8 lightning rounds getting feedback on lab designs. Michael made this real fine image (below) with overview of how well the individual lab designs switched, also in related to the expected max score.


3 designs exceeded the expected maximum ratio. (open dots over the orange lines)


2 of these 3 unexpected high jumpers were spiral designs.



Why do spirals work?

The first set of aptamers we worked with for riboswitches FMN and MS2 had the immediate advantage, that they had sequences that were a perfect match for a direct pair up between the aptamers, meaning that one could make same state switch where the aptamers turned each other off directly.


Similarly both FMN and MS2 had a shared sequence, which was perfect for using a shared sequence between them in exclusion puzzles, so the shared sequence could take turns with turning either the FMN or the MS2 off.


However many of our newer aptamers do not have the same shared sequence or directly complementary stretches.


The beauty of spirals is that they can work no matter if the aptamers are capable of matching directly or not.


What the spirals actually do is to allow an indirect pair up between aptamers that may not be able to pair up directly, like FMN and MS2.


Background on the match between FMN and MS2: The FMN piece inside the MS2 hairpin



Spirals and special switch graphs

Many of the designs with spiral arc plots, tend to have a special kind of switch graph, like the design has not yet finished switching and reach its maximum capacity for switching.


Here is the switch graph of Cynwulf’s maximum ratio overriding design:

                 


Background: 

Special switch graph signature

More on switch graphs



Spirals and aptamer self turnoffs

Aptamer self turnoffs - which are aptamers turning themselves off by pairing with their own sequence, just binding in a different manner to when they bind their molecule. 


Aptamer self turnoffs can themselves sometimes create spirals. This happens eg. with some tryptophan solves. Both the theophylline and tryptophan aptamer are heavily involved in aptamer self turnoffs and in causing spiralling.


Zama’s TRYP B SS (MGA) ZZ-1-18 from the Tryptophan B Same State (MGA) lab that was one of the 3 switches to exceed the expected maximum ratio, is both a spiral and has its tryptophan aptamer involved in self turnoff.


https://eternagame.org/game/browse/8787268/?filter1=Id&filter1_arg2=8813946&filter1_arg1=8813946


Cynwulf’s Set 2 Design 001 from the Tryptophan B Same State (Spinach) lab that was the other high jumping spiral design, also uses tryptophan aptamer self turnoff.


Static stem deletion and spirals

I was testing if a static stem really was necessary in FMN/MS2 designs, by deleting static stems in already successful designs and I expected these designs to fail.

One of these designs however did better than the original design with the static stem and this exact design had a spiral arc plot. Otherwise the static stems were beneficial to designs that holds circularized arc plots. Spiral designs can still benefit from static stems, however they prefer them somewhere different. Namely at their one aptamer end.  


Static stem deletions to more regular circularized designs, may create spiral designs.


Background: Static stem deletion mystery solved



Spirals and static aptamer ends

While we have made spirals work without giving both aptamers one static end, I find it worth to highlight that the two spirals that exceeded the maximum ratio, both had two static aptamer ends.


https://eternagame.org/game/browse/8789143/?filter1=Id&filter1_arg2=8998484&filter1_arg1=8998484


Background: No static stem at the aptamer end opposite the MS2



What is the benefit of spirals?

  • Because size matters:


Spirals make allowance for bigger switches - and bigger fold change. This gets around the problem with too long stems that may arise that can kill a switch. 


Because designs with circular arc plot tends to have stems. The longer stems get the less switchy they get. So there may be a limit to how big circularized switches can be. Switches with spirally arc plots can consists of several but smaller stems that are lining up as a train. They have the two sequences between their aptamers switch in parallel and a antiparallel movement. Whereas designs with circularized arc plots switch in a perpendicular manner.


  • Limits solve space:


While designs with spiral arc plots tends to be longer than designs with circular arc plots and as such uses more bases, there are still only are a limited number of ways one can make a spiral. Because the definition of a spiral is a bend in a specific direction. Plus the arc plot has to cross the line between states. So knowing that a spiral design can solve a design task, limits the space of possible solutions.



Image by Omei, background: The Maze of the arcplot



  • Size adjustment:


The spirals can be adjusted in length to fit the amount of bases one is given. A spiral can involve a direct complement to either 1 or both of the aptamers.


  • The switch may happen in a more gradual manner


As jandersonlee said: If you can 'roll' (or unzip/rezip) the base pair like this you don't have to break all the bases to change states. If the aptamer bases can switch first, they can perhaps free whatever blockage is preventing the reporter site from forming.



Spirals and circularized winners and reuse of switching bases

One thing that designs with cirularized arc plots have in common with the designs with spiral arc plots are that many of the same bases that are involved in base pairing in state 1 is also involved directly in base pairing in state 2 - just somewhere different.



Background: The maze of the arc-plot



Spirals are the Schrodinger's cat of RNA

Arcplot from Zama’s maximum ratio high jumper design. Notice how all the bases marked with blue are connected in both state 1 and 2 at least one time.



While the RNA can physically make what the spiral pairing up that is suggested with a spiral arc plot, the arc plot shows the potential for dual states.


The yet unfolded individual RNA bases are in a mixture of states - quantum state. With an option of being bound two different places. Although not at once.


Spirals and chain reaction

Not even can bases have two home states, groups of bases can move in concert and just as a single base can have two homes, so can groups of bases. Dependency chains as jandersonlee calls them.


Some of these bases are even involved in chain interactions more than two places. Here are two chain interactions marked with different colors:



Spirals are basically a way of getting a maximum of bases involved in base pairing (of the switching kind) in both states.



Where have the spirals shown up?

Spirals showed up as as winners or near winners in labs before the lightning rounds


Winners:


  • Small Loop Same State NG 3 (R101)

  • Inverted Small Loops Same State NG 3 (R101)

  • Exclusion NG 2 (R101)

  • Same State - Tryptophan B (R107)

  • Exclusion - Theophylline A (R107)

  • Same State - Arginine B (R107)

  • Exclusion - Theophylline B (R107)

  • Same State - Theophylline B (R107)

  • Same State - Theophylline B (107)

  • Exclusion - Theophylline B (R107)


Near winners with scores above 90%:


  • Inverted Small Loop Small State NG1 (R101)

  • Inverted Small Loop Exclusion NG1 (R101)

  • Small Loop Same State NG 1 (R101)

  • Inverted Same State NG 1 (R101)

  • Inverted Same State NG2 (R101)

  • Same State NG 2 (R101)



Spirals as top dog in labs that were hard to solve 

Sole top scorer below 94%:


  • Exclusion - Tryptophan A (R107)


Sole top scorer below 90%:


  • Same State - Tryptophan A (R107

  • Exclusion - Arginine B (R107)

  • Same State - Arginine B (107)

  • Exclusion - Arginine B (R107)

  • Exclusion - Tryptophan A ((R107, Kissing Loops)

  • Exclusion - Theophylline B (R107, Kissing Loops)


A lot of the hard labs that did not have winners, had some of their topscorers show partial spiral behaviour.  



Spirals and fold change

Not only do spirals turn up as top scorers in hard labs. In some of the labs where they have competition by the more usual designs that causes circularized arc plots, they bested the other designs by fold change, while not always achieving the top score. This is impressive, especially when taking into account that spiral designs up till the lightning rounds have been a lot rarer than circularized designs


Spiral designs coming out with top fold change for their lab (With fold change error limited at max 1.25)


  • Exclusion - Theophylline B design (R107)

  • Same State - Tryptophan A (R107)

  • Exclusion - Arginine B (R107)

  • Inverted Exclusion NG 2 (R101)

  • Inverted Same State NG 2 (R101)

  • Small Loop Same State NG 1 (R101)

  • Small Loop Same State NG 3 (R101)

  • Inverted Small Loop Same State NG 1 (R101)

  • Inverted Small Loop Same State NG 3 (R101)


Thx to Zama for catching some of my mistakes. I alone bear responsibility for the rest. 


(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
The spiral and the bachelor's dilemma in double


First a big thx to Zama for questions and discussion. Also thx to Omei for listening to my first rambling on double bachelor’s dilemma in spirals.


Zama has been asking me to explain more on what I say about racetracks, circularized arc plots and spiral arc plots. As she said: “...but there are circles in all arcplots so my head just wants spirals and racetracks and clowns to be a subset of circulars.”


She asked for visuals. She got a point, so here we go.


There really are a lot of circulars in a lot of arc plots, also the bad ones. But these arc plots tends to be a lot more irregular and swirly as Rhiju calls them.


They also tends to get really long. Which is okay if they are spirals, but not if they are not.


But Zama have a point of spirals having something really circular to them. They are moving in shrinking or growing circular movements.



Arc plots and no crossing


Circularized arc plots and spiral arc plots have something else in common.


Their road tracks don't cross over. Like in an infinity symbol


I have actually seen an arc plot for a design do something like this, although I forgot which.



Circular arc plots take the straight route


This is a circularized arc plot from a winning design:


GCACCAGGUACGGAUACCAGACGUUGCCAAACAGGGUGACAUGAGGAUCACCCAUGUACUGUCCCUUGGCAGCCGUACCUGGUGC



Zama: The clown


Eli: Yup. Notice what the road do. It moves directly through all the aptamer parts.

Two times each

No extra detours


Zama: They lap back and forth


Eli: Yup


Design as shown in game, with the aptamer sequences highlighted.




Circularized designs that do less well, tend to take more detours



Spiral arc plots takes detours, although in a systematic manner. 


Here is a winning spiral design (by Pi). Here the road track goes a lot different.


GCACCAGGUACGGAUACCAGACGUUGCCAAACAGGGUGACAUGAGGAUCACCCAUGUACUGUCCCUUGGCAGCCGUACCUGGUGC


Design as shown in the game with the aptamers marked:



It goes from the theophylline aptamer, to a non aptamer area which again hooks up with the other aptamer (MS2). This is an indirect pairing.


I have been thinking about spirals kind of like being a double bachelor's dilemma in one puzzle.


When I mentioned the idea to Omei, he said: “I think I understand, and agree. To me, this kind of spiral seems closely related to the entangled pairs pattern.”


Tutorial puzzles on the bachelor’s dilemma:

RiboSwitches #1: Bachelor's Dilemma - The Turnoff Sequence

CRISPR training #1: Shared sequence - Bachelor's dilemma


Second part of spiral and second bachelor’s dilemma



It isn't always the two aptamers can share a common sequence like here.


But then if one can't hit the other aptamer in the third step, then one can aim for the aptamer gate instead. The aptamer gate can have its sequence changed to what is needed, unlike aptamers.


So one can always make a fit between two aptamers, by using sequence in between. Just like in the bachelor’s dilemma.


So basically the spirals either as single or double spirals works as bachelor’s dilemma. But there can be more than one inbetween sequence. But also fewer steps. The amount of strands between the two aptamers can vary. Depending on need. One can even make a spiral so short that one makes only a complementary sequence to one of the aptamers.



The difference between designs with spiral arc plots and circularized arc plots


So the main difference between designs with true circularized arc plots is that the circularised arc plots take the shortest route through all the aptamers (or really near them), whereas the spirals takes a longer and more indirect route. The later also through none aptamer or aptamer gate areas.


Spirals uses the indirect route to create complementarity between the aptamers, where as circularized designs do a direct pair up between the aptamers and or their aptamer gates.


The circularized designs depends more on short range interaction. Circularized designs do a more jumping move. Aptamers in spiral designs can be further apart. 


Zama: So it's not that one is better than the other but what fits the design???


Eli: What fits the task. How long is the sequence. Is the aptamers fixed somewhere. Etc.


And if one want to make a switch that is likely to work with fewer tries, then one goes for a circularized design. It generally uses much fewer bases and as is easier to make.


However if one wants not just a winner, but a real high fold change, one should consider making spirals. Despite fewer of them are going to work and they are a bit harder to make. Because more bases, so more things can go wrong.


Zama: Which brings me back to the Round 5 comparison between Astro and JR's. One spiral and one clown.- The opposite of what you just said though.


Zama: This is JR's



Eli: Circularized with an extra arc


Zama: Astros


Eli: spiral


Zama: Yes, but in this case the results graphs are very similar and the circularized is the top design overall


Eli: Ok, I got what you are saying and you are right. The circularized designs is the best. For now.


I think the spirals have the potential to best circularized designs in the future.


Because I have seen it happen in a few of the past labs.


Zama: Me too!


Eli: So I had the mouth a bit too full and not saying that I was in prediction mode not exact fact mode. I sometimes forget.


Zama: I think the reason these two scored so well is because the spinach was about as far away from the aptamer as possible- on both. My hypothesis. Most of JR's reasons in his post didn't hold true in Astros.


Eli: This is a good observation. This also expand the space of the fold. It is generally helpful for same state designs.


JR's is a bit unusual in that it had its two aptames unevenly spaced. It has a bend. This is more typical for exclusion circularized designs



Photo of JR

JR

  • 241 Posts
  • 20 Reply Likes
I would say the design by Astromon - Astro_modly_mod3 does meet the criteria in my independent post.



The design starts with a static stem, followed by the spinach aptamer, followed by the folding area, followed by the molecule aptamer , and finishes with another static stem. In this design the folding area slides or shifts the design to switch between states. 

Arc Plot stats are as follows:
G11:C74  | S1:    0.57 kcal   38.63% | S2:    0.07 kcal   89.71% | ON  2.32x FMNgc
U18:A68  | S1:    2.92 kcal    0.79% | S2:    0.11 kcal   83.36% | ON  106.10x FMNgc
A28:U46  | S1:    3.06 kcal    0.62% | S2:    0.35 kcal   55.66% | ON  89.36x MS2

         
GGGUACAUCGGAGGAUAUCAUGUAAAUACAUGAGGAUCACCCAUGUCGAUGGAGACAUCGGAGGUUGAGAAGGCCGAUGUACCG     1.30
.((((((((((..(((.((((((....))))))..)))..))...((((((....)))))).((((.....)))))))))))).   -32.90
.((((((((((......(((.......(((((.((....)))))))(((((....))))).....))).....)))))))))).   -34.20     


Photo of Astromon

Astromon

  • 192 Posts
  • 25 Reply Likes
my design Modley mod 3 actually has these arc-plot reading>
http://prntscr.com/lqdcyi    , you might have mine confused with someone else?
Photo of Zama

Zama

  • 37 Posts
  • 9 Reply Likes
What you state is true, but I was trying to point to the quandary that it didn't meet all of the same criteria as yours and had a different style of arcplot, but the results graphs were still amazingly similar.  Of your six points listed, he matched only 2 or 3.  I thought it was interesting and was looking for other explanations for the very similar results. Both being so far from the aptamer was a similarity. 
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2232 Posts
  • 494 Reply Likes
Prediction for the ATP aptamer labs


Astromon asked me: 
@eli i have a question, that thing you predict which labs will do well (A vs B) will that spill over into the new labs?

eli: @Astromon, yes. I expect this to also hold for the new labs. One of the types will do worse than the other. Because aptamers have personalities. They are not equally happy about being hugged and held in between another aptamer sequence. 


How I predicted the last set of labs


The way I predicted for the A and B type labs last time was that I already knew how one of them had done. If the A type has already worked well, then it was easy to say that that the B lab would fluke or the reverse. This has held for previous riboswitch labs.  


No data on ATP yet this round


This round however we are having a new aptamer (ATP) that we have not worked with before. Also I do not have any of the partner labs to give a tip on which lab. However I have decided to give it a try anyway, but gone entirely differently about it. 


My prediction
              
           


Basically I think that: 
  • The ATP aptamer will do best when in between the MGA aptamer sequences
  • The Spinach aptamer will do best between the ATP aptamer

NB, there is one of the Exclusion Spinach labs, which seem to be only solvable when the aptamers are entangled.