Please review the proposed puzzles for the initial OpenCRISPR round

  • 2
  • Article
  • Updated 2 years ago
Nando has create a set of 28 puzzles that meet Johan's approval in terms of the experimental process.  But before formally launching the challenge, we would like to make sure they are all reasonable from the perspective of players solving them in silico.  And for that we need everyone's help.

If you're willing and able to help, I suggest starting by picking one of the 4 projects at random (so everyone isn't working on the same puzzles) and try solving multiple (or all) the puzzles in that project (but not necessarily from top to bottom).  As you solve puzzles, post the results here.  I guess I'll create a spreadsheet to keep tally of which ones have "approval" or have flags raised. I'll post again when I've done that.

This should be a very interesting challenge, from many points of view!
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
  • eager to get started

Posted 2 years ago

  • 2
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Hi Omei, just wondering what you wanted included as results. Thanks
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 967 Posts
  • 304 Reply Likes
No need to provide a specific solution.  We're mostly looking for a Yes, it seems like a reasonable puzzle, or something about it that makes you question it.  For example, you found it unusually hard to find any solution, or it seemed like there would be a limited number of (essentially different) ways to solve it.

If you want to go beyond that and suggest a way to improve it, that's welcome, too.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 967 Posts
  • 304 Reply Likes
On second thought, maybe it would be good to include the solution sequence, so I can at least spot-check that we have a common understanding of which puzzles we're talking about.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
Tetracycline-OFF, sequence: GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCACAUGAGGAUCACCCAUGUCCUGUAAAGAAAUAUAAAGAAAUAUAUGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU _.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
I'm not sure either AndrewKae.  Trp 1b-ON, sequence:GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAACCCUUGGCAGCAAAGAAGAAAGAAAGAAAGAAAGGAAAAGAAAAGAAUUUUUUACAUGAGGAUCACCCAUGUUGAUACCAGAAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU _.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
RE: TEP-1b-ON: The bases were so overlaid on my monitor that I couldn't tell where the target bases should be.  I could not meet the target shape.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Can you elaborate on your overlay problem with TEP-1b-ON?  I've had this problem with other puzzles, but not this specific one.  I'm wondering whether different players are seeing different things.   Here's what it looks like for me:
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
I was using the non-target mode. That's what confused me.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Right.  Are you OK with it by switching between modes as needed?
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
Yes, a nice challenge.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

TEP 1 - A series


CRISPR/Cas9 - TEP 1a - ON

Ugly solve. Has MS2 positioned more like in an OFF switch


GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAGAUACCAGCCAAUCCACAACGUGGAAACACGAAUAAAUAAAUAAAGGGACAUGAGGAUCACCCAUGUGGGCCCUUGGCAGCUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


http://www.eternagame.org/game/puzzle/7949756/


CRISPR/Cas9 - TEP 1a - OFF


Quick and ugly solve. Can solve in an OFF switch style with MS2 next to the aptamer as I prefer. However this solve is pretty sensitive to whatever else I do to break the way too many a's in line.


GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAGAUACCAGACAUGAGGAUCACCCAUGUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUGUCCCUUGGCAGCUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


http://www.eternagame.org/game/puzzle/8047744/



TEP 1 - B series


I think the B series has better shot at doing well than the A series. Was far easier solving. I think the aptamer is optimal oriented for a better switching options.



CRISPR/Cas9 - TEP 1b - ON


Can be solved following blueprint. Having MS2 straight opposite the THEO aptamer, which is typical for an ON switch. Follows blueprint. Can be made symmetric.



GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCCUCAACGUUAGCAAAAGCUAACGAAAUAACAUGAGGAUCACCCAUGUAAAAUAUAAACAUGGGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


http://www.eternagame.org/game/puzzle/7952179/


CRISPR/Cas9 - TEP 1b - OFF


Can be solved following blueprint. Having besides the the THEO aptamer, which is typical for an OFF switch.


GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUUCCCUUGGCAGCACAUGAGGAUCACCCAUGUUAAAAUAAAUGUAUGUCAUGAGGAUCACUCAUGUUGUACAUGUGAUACCAGAAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


http://www.eternagame.org/game/puzzle/8047745/

(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I think the Theopylline aptamer wants traditional orientation. This is the way it turns when it is positioned in the sequence as a continous sequence. (Unsplit) It has the bigger internal loop pointing towards the switching area. I think it wishes to turn that way too, when it is split also.

Can the A series with the inversed aptamer be make working, probably. But I think the one particular orientation of the aptamer will be easier and better.

So basically I think the TEP puzzles looks fine. Except for the A's series. I would still love to see how they do.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes

Additional TEPs



CRISPR/Cas9 - TEP 2 - ON


Ugly solve


GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGAUGGGUGAAAAUAUUAACCCUAAAAGGGAUACCAGCCUGAAAAGGCCCUUGGCAGCCUAAUAAACAUGAGGAUCACCCAUGUACUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


http://www.eternagame.org/game/puzzle/7953274/


Just for the fun of it, I also tried place in MS2 as a split hairpin and treat it just as if it was an aptamer. It will probably not be too fond of it in practice, since the small hairpin loop is exacly where the MS2 virus protein binds. And that is the loop I'm splitting. 


My intention however was to be allowed to solve this puzzle in my favored blueprint style. So here I let the MS2 take the aptamer spot - because the natural MS2 spot are already taken by the Theo aptamer.


In the best FMN/MS2 labs (Same state NG 2 and Exclusion NG2), the whole puzzle were akin to a balloon. A neck was holding a sequence bubble - wherein the switch elements like the MS2 and FMN aptamer tended to prefer being placed in rather specific ways. The FMN aptamer was attached to the neck and the MS2 was placed right across the FMN aptamer in the Same state case, or right beside it in the Exclusion case.


GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUACAUCCCAUGUAAAAUAAAAUAAAAGGGAUACCAGCCUGAAAAGGCCCUUGGCAGCCUCAUGUGAAAUAAACACAUGAGGAUUAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU



CRISPR/Cas9 - TEP 2 - OFF


Exclusion style blueprint with MS2 next to the aptamer

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAGGAAGCGGAAUCGCAAAAUAAAAGUGAUACCAGUGCAAAAGCACCCUUGGCAGCACAUGAGGAUCACCCAUGUAAAACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


http://www.eternagame.org/game/puzzle/8047746/

Photo of cynwulf28

cynwulf28

  • 80 Posts
  • 22 Reply Likes

Controls are essential for quality experimentation so I started there. I quickly obtained a sequence for CRISPR/Cas9-Control ON

[http://www.eternagame.org/game/puzzle/8047255/]: GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCUCUAUGAUAUUCGCGAAAGCGAAUAUAUACCACAUGAGGAUCACCCAUGUGGUAUAUACAAUGGAAACAUUGUAUCAUAGAGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU 

   I pasted this same sequence into the CRISPR/Cas9-Control ON (freestyle) puzzle as well [http://www.eternagame.org/game/puzzle/8047523/].

   

    I began the CRISPR/Cas9-Control OFF puzzles as well  [http://www.eternagame.org/game/puzzle/8047448/ and http://www.eternagame.org/game/puzzle/8047524/] and noticed several things about these four puzzles:

1)    The Oligo (Target DNA: CUGCGUAUUUCUACUCUGAG) is bound in every single state which confers -39.3 kcal of energy (through bonds), yet there appears to be a penalty of 28.22 kcal listed where the energy from the Oligo would normally appear.

2)    Having pasted the exact same sequence into each of the four puzzles I looked at the Total Energy listed (sans the 28.22 kcal) and found that for the CRISPR/Cas9-Control OFF, OFF (freestyle), and ON (freestyle) the number provided (in white) was -114.2, while for the CRISPR/Cas9-Control ON the energy given was -113.8. The difference comes from a single bond (GU) which is formed (ONLY in Control ON) between bases 21 and 131. This bond adds -1.4 kcal of energy to the stack while causing the energy in the open “hook” to be -1.5 kcal. This bond does not form in the other three puzzles where the unpaired bases make the hook energy -5.4 kcal.

3)    In the Control OFF puzzle one of the criteria is that the, “MS2 hairpin must not form in state 1” (despite the puzzle not actually being a switch with Control ON [is that the plan?]), yet the outlined structure that the RNA is required to fold into INCLUDES THE MS2 HAIRPIN! Thus, if the MS2 sequence (ACAUGAGGAUCACCCAUGU) is pasted in the same place as in Control ON puzzle, then this puzzle is unsolvable. Luckily the puzzle is possible if we stamp the MS2 hairpin elsewhere in the puzzle. The following sequence demonstrates how CRISPR/Cas9-Control OFF may be solved: GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAUAAUAUGUGAUAUAUGAAAAUAUAUUGUCCUCAUGUUAGGGAAACCAACAUGAGGAUCACCCAUGUGAAUGGGUGGCAUAUUAUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU.

4)    However, the stamper tool pastes more than just the MS2 sequence.

        Here are the sequences stamped if one were to click on the same base with the stamper tool repeatedly: 1st stamp=ACAUGAGGAUCACCCAUGU, 2nd = ACAUGAGCAUCAGCCAUGU, 3rd = ACACGAGGAUCACCCGUGU, 4th= ACAAGAGGAUCACCCUUGU, 5th= ACAGGAGGAUCACCCCUGU, 6th= ACCUGAGGAUCACCCAGGU, 7th= ACCUGAGGAACACCCAGGU, 8th= ACCUGAGGAUCACCCGGGU, 9th= ACCUGAGGAUCACCCUGGU, 10th= ACGUGAGGAUCACCCACGU, 11th= ACUUGAGGAUCACCCAAGU, and so on. Clicking incessantly the MS2 sequence will be stamped every 25th click or so [will say, “present in (1)” in the objective box].    

   That's all I had time to do thus far, but hope to try out the rest of the puzzles later on. 
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Thanks for the detailed comments, @cynwulf28.  I'll try to address them.

Re 1 and 2, there are known quirks/defects in the  energy model.  There are also three different energy models, that produce three different results.  So I guess my question is whether there is anything in 1 and 2 that you think is a significant impediment to solving these puzzles?

Re 3, the purpose of the puzzle is to create solutions that contain the MS2 sequence, but the sequence is bound up in some other structure (which is what should happen for an OFF puzzle.)  So I think everything you said is accurate except for "Luckily". :-)

Re 4, congratulations! You've discovered a little-advertised feature of the stamper for stamping in other variations on the MS2 sequence.  Research from the Greenleaf lab indicated that these variations bind to the MS2 protein almost as well or even a little better, than the default MS2 sequence.  I know some players (including me) have experimented with using them, but I'm not sure if anyone has published any conclusions about them.
Photo of cynwulf28

cynwulf28

  • 80 Posts
  • 22 Reply Likes
Thank you Omei for the information :-)
Photo of cynwulf28

cynwulf28

  • 80 Posts
  • 22 Reply Likes
I have reworked a solution for the Control-OFF puzzle: 
http://www.eternagame.org/game/puzzle/8047448/ 

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUGACAAUGCUCAUGUGAAAACAUGAGGAUCACCCAUGUGCUUUAGCCAUGGGUGAUCGAGUUACGUGAGUAACUCCAUUGUCAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
 
The sequence is stable across Folding Engines and gives an MP of 97°C for Vienna and NuPACK, but interestingly gave an MP of 107°C for Vienna2.

 I also notice that the pairing probabilities plot does not seem to work with NuPACk, is this correct? 

Final thought (for now) on this design. If one's goal is to stabilize the shape across all three folding engines then there are only a few places (2 or 3 places per hairpin) that the MS2 can be stamped such that the central 4-way junction will be stable in all of them. This limits ones options greatly for possible solutions using this methodology.
The number of places to stamp goes up significantly with the introduction of a single base pair per stack and decreases significantly if the stacks are reduced by a single base pair. 
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Now that the puzzles are finalized, there is no explicit goal for a design to be judged as good by all three (or even any!) of the energy models.  It's all up to player judgement now, with the folding engines there solely for advice.

FWIW, I think experienced players tend to consider Vienna2 to be the engine that best correlates with our lab results.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Re the partition function (dot plot), NUPACK seems to be working for me.  Try rebooting your machine.  If that doesn't work for you, post again, but better a new post at the end of the topic, where more people will see it.
Photo of spvincent

spvincent

  • 48 Posts
  • 9 Reply Likes
TEP 1b OFF (not very inspiring solve)

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAGCCCUUGGCAGCUAAAAUUAGCUAAAUUAUAAUAGAUUCAUGUAAAACAUGAGGAUCACCCAUGUAAUAGGAUAGAUACCAGCUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
FMN-1a-ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAAGGAUAUUAAUUAACAUGAGGAUCACCCAUGUGAAGACACUAGUUGGAGAUUCUCCGACUAGUGUCACACAUGAGAAGGUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Seems to be a lot of potential variability for solutions.

FMN 1a - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAAGGAUAUGCAAAGAGUAUGAUGAUGAGAUGUAUUCAUCUCAUCAUCGUACUCAAACAUGAGGAUCACCCAUGUAGAAGGUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Again, appears to be a lot of potential variability for solutions.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
CRISPR/Cas9 - FMN 2 - ON

Ugly solve, not much blueprint here

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACCCAAAUAUAAAAUAAAAUAAAUCCUAAGAAGGAUAUCCGGAAACGGAGAAGGUCUCCUAGUAAAACAUGAGGAUCACCCAUGUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

http://www.eternagame.org/game/puzzle/8038693/

CRISPR/Cas9 - FMN 2 - OFF

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACCCAAAAUAUAACAUGAGGAUCACCCAUGUAGGAUAUAGGAAAACCUAGAAGGACAAAACCUCAGACAAAAGUCUGAGGAAAGGGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

http://www.eternagame.org/game/puzzle/8047738/
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Here's a compact skeletal solution for Tetracycline inv - OFF

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGAGAGGUGAAGAAUACGACCACCUAGACAUGAGGAUCACCCAUGUAAAAAAAAAAAAAAAAAAAAAAAAUGUCUAAAACAUACCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
... and a similar one for Tetracycline inv - ON

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGAGAGGUGAAGAAUACGACCACCUAGAAAAAAAAAAAAAAAAAAAUACAUGAGGAUCACCCAUGUUUUAGAUCUAAAACAUACCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
CRISPR/Cas9 - Tetracycline - ON

It can be solved in blueprint style.

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCUCAAUAAAUAAAACAUGAGGAUCACCCAUGUAAAAUAAUAAGAAAGGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

http://www.eternagame.org/game/puzzle/8040919/


CRISPR/Cas9 - Tetracycline - OFF

Also the partnering lab can be solved in blueprint style

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCACAUGAGGAUCACCCAUGUAAUAAAGAAAGGUGAUUACAAAAUAAAGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Astromon

Astromon

  • 183 Posts
  • 23 Reply Likes
FMN 1a-on- GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAGAGGAUAUAAAGUAAAAUAAAAUAAAACAUGAGGAUCACCCAUGUACAACAUGAGGAUCACCCAUGUCACCCUUAGAAGGUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU -vienna1
TEP-1-a-on-  GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAUGAUACCAGUGAAUAAUAAUAACAUGAGGAUCACCCAUGUCAUGUAAUAAAAUAAAUAAAAUAAAAUAACGCCCUUGGCAGCAUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU -vienna1

Tep-1-a-on-venna2- GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAUGAUACCAGUGAAUAAUAAUUACAUGAGGAUCACCCAUGUCAUGGAAUAAAAUAAAUAGUCUAAGAUAACGCCCUUGGCAGCAUUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
OK, I have a spreadsheet for keeping track of what has and hasn't been solved - https://docs.google.com/spreadsheets/d/1DLUBU4LssU4HWyyFLqUi_LpfFyl8XP95W2xYUKQ-gps/edit?usp=sharing.  You can consult it if you want to see which puzzles haven't had any solutions submitted, or just to make sure that I have recorded your own.  Feel free to leave comments in the spreadsheet if you see something in the spreadsheet that doesn't seem right.

Thanks for all the quick responses!
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
FMN 1b - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAAGAAGGUACAAAACAUGAGGAUCACCCAUGUAAUAGUAGAGUUAUGAAUUCAUAGCUCUAUAAGUUACAUAGUGAGGAUAUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Seems to have a lot of potential variability.

FMN 1b - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAGAAGGUAUAUAUUAAUUCUUAAGAUGUAGACUGUCUAUUGAUAGUCUACAUCAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Again, appears to have a lot of potential variability.
Puzzle appears to be unsolvable in NuPACK, all in the locked portion.
Photo of Astromon

Astromon

  • 182 Posts
  • 23 Reply Likes
I too have noticed in Nupak the locked bases forming a structure breaks apart.
I was able to get designs with both vienna, and vienna2. Thanks
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
FMN 2 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUGUCAAACAUGAGGAUCACCCAUGUAAAGAAGGAUAUGAGUAUUCUCAGAAGGUCUUCAUGUUAUUUAUUUAUAUUAUUUAGACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Still seems to be plenty of potential variability.

FMN 2 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUCGCAUUUAUAACAUGAGGAUCACCCAUGUAGGAUAUGCGUAUUCGCAGAAGGAUAUGGAAGUAGACUGAUUCAGUCUACAGCGAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Still seems to be plenty of potential variability.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
FMN 3 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAACAUGAGGAUAUGUGUAUUCACAGAAGGUAUAAGAUGAUGUAUUCAUCAUCAAUACAUGAGGAUCACCCAUGUUUUAUGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Still seems to have plenty of variability.
Appears to be unsolvable with NuPACK, again the static locked bottom portion.

FMN 3 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUCAAAUGUAGGAUAUCUGUAUUCAGAGAAGGACAUGAGGAUCACCCAUGUAAGACUAGAGAUGAUUCAUCUCUAGUCAAAUGAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
This puzzle seemed just a bit more difficult than the rest of the FMN series. Again with the state 2 not solvable with NuPACK. Seems to have a lot of potential variability.
(Edited)
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
FMN 4 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAGAGGUUGCUCAACAUGAGGAUCACCCAUGUAGGAAAGCCUUAGGCAUCAAGGAUAUUGUUCCUACAAGAAGGUGAAUAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Ugly solution.

FMN 4 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAAGAUGAUCGAGACUAUUGUCUCGAUCAUCAACAUGAGGAUCACCCAUGUAGGAUAUCUCUAUUGAGAGAAGGACAUAAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Thank you, @AndrewKae, for bringing up the issue with NUPACK predicting that the oligo will fall off. I'm going to bring up this up with the devs that designed the puzzles, but let me explain why it might be left just as it is.

In a real CRISPR system, what appears in the puzzle as an RNA oligo is actually a segment of genetic DNA. Base sequences 1-20 in the puzzle represent the CRISPR single stranded "guide" RNA strand that binds to the the DNA, which is what allows CRISPR to latch onto a specific segment of DNA.   For the CRISPR mechanism to be effective, the guide RNA can't be binding to some other part of the CRISPR mechanism (which includes our switching portion our designs) in preference to the DNA oligo.  So falling off of the DNA is a real phenomenon that has to be taken into account.

What I don't know, though, is whether the specific DNA segment in the puzzles was carefully chosen so that the guide sequence had a pretty strong tendency to pair with the other locked CRISPR bases, to ensure that this issue could and would show up in the in silico puzzles. I certainly suspect it was chosen with that in mind.  

I also suspect that the puzzles can be solved, even in NUPACK, but that it may require starting over with a fresh approach.  So if you've for the energy for it, keep trying.  Meanwhile, I'll talk with the devs and get back to you.
(Edited)
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Thanks for the explanation Omei. If you find solutions for the ones I mentioned please let me know.
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
TEP 3 ON:

easily solved (ugly solve), not sure about further analysis

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAAACACAAUGAUACCAGAGAAACCACUCCCUUGGCAGCAUAAACAUGAGGAUCACCCAUGUAAACAUGGAAAUAACACAACACAAAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
Vienna btw
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
TEP 3 OFF:

again, easily solved (ugly solve), not sure about further specs
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAACCAAAGUGAUACCAGAGUAAUAACUCCCUUGGCAGCACAUGAGGAUCACCCAUGUAAAUUUAUUUAAUUCUAACAAAACAACAAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
Vienna btw
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
TEP 4 ON

one of the requirements is "at most 4 A's in a row", the sequence below gives all green (= a solve) but between bases 155 and 160 there are 5 A's in a row... Is this allowed because they are locked ? Or am I missing something else (newbie...)? Same for TEP 4 OFF...

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAACAACAACUCACAUGAGGAUCACCCAUGUUACAGGGAACACACAACGAUACCAGAAACACAAUUCCCUUGGCAGCGUAGAACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
(Edited)
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
And for completeness' sake:

TEP 4 OFF:
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAACAAAACUAAACAUGAGGAUCACCCAUGUUAGAGGGAAACAACAACGAUACCAGAAACACAAUUCCCUUGGCAGCGUAGAACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
Thank you, everyone.  I think we have at least one solve for all the puzzles.

The major concern that has surfaced is that some puzzles seem difficult, or perhaps impossible, to solve for NUPACK.  This is a concern, and we would like to get more information about how extensive this is before making a final decision on the puzzzles.

I'm going to add a new column to the spreadsheet to record solvability in NUPACK.  Could you now specifically try for NUPACK solutions, posting either successful designs or unexpected inability to come up with one?
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
FMN 1a - ON
In NuPACK with FMN bound in state 2 the guide sequence from nt 14-20 mispairs with nts 135-148
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Yes, that's seems to be the the typical symptom.  By strengthening the desired folding, I can satisfy state 2 (complete with DNA binding) in NUPACK, but haven't been able to satisfy both states at the same time.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
NuPACK
FMN 1a - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGGAGGAUAUACAAAGAGUAUGAUGAUGAGAUGUAUUCAUCUCAUCAUCGUACUCAAACAUGAGGAUCACCCAUGUAGAAGGCCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
NuPACK
FMN 1b - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAAGAAGGUACAAAACAUGAGGAUCACCCAUGUAAGGCUAGAGUUAUGAAUUCAUAGCUCUAGCCAAUACAUAGUGAGGAUAUUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
NuPACK
FMN 1b - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGCAGAAGGUAUAUAUUAAUUCUUAAGAUGUAGACUGUCUAUUGAUAGUCUACAUCAACAUGAGGAUCACCCAUGUAAGGAUAUGCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
NuPACK
FMN 2 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUGUCAAACAUGAGGAUCACCCAUGUAAUGAAGGAUAUGAGUAUUCUCAGAAGGUCAUCAUGUUAUAAAUAAAUGAGAUAUAGACAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
An admittedly ugly design, still with all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148

NuPACK
FMN 2 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUCGCAUUUAUAACAUGAGGAUCACCCAUGUAGGAUAUGCGUAUUCGCAGAAGGACGUGGAAGUAGACUGAUUCAGUCUACAGCGAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148

NuPACK
FMN 3 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAACAUGAGGAUAUGUGUAUUCACAGAAGGCAUAAGAUGAUGUAUUCAUCAUCAAUACAUGAGGAUCACCCAUGUUUUAUGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148

NuPACK
FMN 3 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGCAAAUGUAGGAUAUCUGGAUUCAGAGAAGGACAUGAGGAUCACCCAUGUAAGACUAGAGAUGAUUCAUCUCUAGUCAAAUGCGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148

NuPACK
FMN 4 - ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGGAGAGGUUGCUCAACAUGAGGAUCACCCAUGUAGGAAAGCCUUAGGCAUCAAGGAUAUCGUUUCUACGAGAAGGUGAGUACCCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148

NuPACK
FMN 4 - OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAAGAUGAUCGAGACUAUUGUCUCGAUCAUCAACAUGAGGAUCACCCAUGUAGGAUAUCAGGAUUCUGAGAAGGGCAUGAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
With all other constraints met, in state 2 the guide sequence from nt 11-20 mispairs with nts 135-148
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Thank you Andrew, for continuing to post these.  Nando and I have discussed the issue, and he is going to experiment with tweaking the NUPACK parameters to see if it brings the predictions more in line with Vienna's.  But then, it may be NUPACK that better predicts what will actually happen in the lab. In either case, your solutions will be an important part of making that judgement call.