Please review the proposed puzzles for the initial OpenCRISPR round

  • 2
  • Article
  • Updated 2 years ago
Nando has create a set of 28 puzzles that meet Johan's approval in terms of the experimental process.  But before formally launching the challenge, we would like to make sure they are all reasonable from the perspective of players solving them in silico.  And for that we need everyone's help.

If you're willing and able to help, I suggest starting by picking one of the 4 projects at random (so everyone isn't working on the same puzzles) and try solving multiple (or all) the puzzles in that project (but not necessarily from top to bottom).  As you solve puzzles, post the results here.  I guess I'll create a spreadsheet to keep tally of which ones have "approval" or have flags raised. I'll post again when I've done that.

This should be a very interesting challenge, from many points of view!
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
  • eager to get started

Posted 2 years ago

  • 2
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 1b - Same State
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCAUGAAACAUGAGGAUCACCCAUGUAGAUGAGACAUUUGUCUCAUCUUCGUUUUGAACCUCAUGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 1b - Exclusion
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACACCCUUGGCAGCACAUUAAAGAUCUCUCGAGUCAUUUGACUCGAGAGAUCAAAUUACAUGAGGAUCACCCAUGUGAUACCAGUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 2 - Same State
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAGAACAUGAGGAUCACCCAUGUAAAAUGAUACCAGCAGAUUUCUGCCCUUGGCAGCAUGGGUAGAGCGAUUUCGCUCAAAACUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 2 - Exclusion
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAGUAUAUGAGUGAACACAUCGGAAGGUGAUACCAGCUGAUUUCAGCCCUUGGCAGCACAUGAGGAUCACCCAUGUAAUAUACUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Ugly solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 3 - Same State
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACAGAAAAUGAUACCAGAGCAUUUGCUCCCUUGGCAGCAUGUGUAUAAUUAUACACAUGAGGAUCACCCAUGUAAGAAAUAAUCUGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 3 - Exclusion
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGGAUGUGGAUACCAGCUCAUUUGAGCCCUUGGCAGCUACAUGAGGAUCACCCAUGUAAGAUCUCUCAUUUGAGAGAUCAAACCGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 4 - Same State
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGAGCAAUAAAUAAUAAACAUGAGGAUCACCCAUGUGAUAAAAUCACAUGAUACCAGCUCAUUUGAGCCCUUGGCAGCAUAAGCUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
TEP 4 - Exclusion
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACAUAAUUGCUCGCAUUUGUGAGCACACACAUGAGGAUCACCCAUGUGAUACCAGCUCAUUUGAGCCCUUGGCAGCACAUUGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Tetracycline - Same State
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCUUAUGUAAAUAAAACAUGAGGAUCACCCAUGUAAAUAAAUAUAUAGGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
This solution was not a mod but turned out to be very similar to Eli's, both work in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Tetracycline - Exclusion
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCACAUGAGGAUCACCCAUGUAAAAGAGCUCAUUUGAGCUCAAAGUGUGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Tetracycline inv - Same State
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGAGAGGUGAAGAAUACGACCACCUAGGAAUCUCAUGUAAAACAUGAGGAUCACCCAUGUAAAUUGAAUGAUCCUAAAACAUACCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Tetracycline inv - Exclusion
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGGAGAGGUGAAGAAUACGACCACCUAGUACAUGAGGAUCACCCAUGUAAAACAUGUAAAUUAAAUAUGAUGUACUAAAACAUACCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Control ON
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAAUAAUAGCUAUAUAGAAAUAUAUAGGAUAUAACAUGAGGAUCACCCAUGUUAUAUCGAAUAUAGAAAUAUAUUCCUAUUAUUAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.

Control OFF
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUCUCUGACCAAUCUCGAAAGAGAUUGUCAUGUACAUGAGGGAAACCCAUGUACAUGAGGAUCACCCAUGUGAUCCGUCAGAGAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.

Control ON (freestyle)
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAUAACUAAAGCUCAGAAGAAAUUCUGAGGUUAGAACAUGAGGAUCACCCAUGUUCUAACGACUAGAGAAAUCUAGUCCUUUAGUUAUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.

Control OFF (freestyle)
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUGUCUGACCAAUCUCGAAAGAGAUUGUCAUGUACAUGAAAGAAACCCAUGUACAUGAGGAUCACCCAUGUGAUCCGUCAGACAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU
Solution works in all 3 models.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Also for those who are not doing puzzles at the moment and may not have noticed, there is a CRISPR training series up under puzzles. The aim is teaching some of the skills for doing good for the coming CRISPR lab. With focus on using what we have already learned from past labs + transfering some of our past winning designs to the CRISPR lab as for making potential winners much faster.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Also I wish to highlight AndrewKae who has made a great puzzle introduction to the Sequence Stamper Tool. Something that will be most helpful when we are transport past working Riboswitch solves onto new CRISPR puzzle.

Sequence Stamper Intro
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
First of all, I want to thank everyone who has helped us test these puzzles.  The feedback resulted in numerous very significant improvements and fixes.  Special kudos are due to Andrew, who submitted solutions satisfying all three folding engines, for all the final puzzle versions!

Barring any last minute surprises, the puzzles are now finalized.  If you are so inclined, you can start working on them now; you just have to keep a copy of your solutions and submit them when the round officially starts.  (When?  Soon, but exact date still TBD.)  But this pause brings up another thought.

Once a lab opens, we are generally too busy working on generating lots of solutions to take the time to discuss our ideas for how to best solve them.  I think we might get a jump on new puzzles if we shared ideas on how we think we can best apply lessons from the past.  Eli has jump-started this with his player puzzle tutorial series.  Are there other thoughts?  @Andrew, you've obviously gotten very good at generating high quality solutions.  Can you share anything about your process?
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
Thanks Omei, 
I've always been big on reading the guides and tutorials created by other players.
Visualizing reverse complements for switches is not easy for me, I have to be able to concentrate. So my main advice is, if you can manage to get that part of your brain working, do what you can to stay in the zone. I am lucky to be able to limit distractions, to help I like to put on some familiar music or listen to Adult Swim cartoons I have heard a hundred times. And of course don't be afraid to fail. Out of thousands of tries I still only have a handful of winners. One of my favorite resources for guides is Eli's profile page.
http://www.eternagame.org/web/player/8627/
Photo of Andrew Kaechele

Andrew Kaechele

  • 82 Posts
  • 22 Reply Likes
One thing I forgot to mention. Before I start working on solutions for a lab I create a folder and individual .txt files for the individual puzzles. I frequently paste the promising sequences and notes into the file and save. So when I loose my undo stack I still have a starting point. I use google drive, so it all stays backed up automatically. Most frequent note: close :)
(Edited)
Photo of rhiju

rhiju, Researcher

  • 403 Posts
  • 122 Reply Likes
to everyone who has contributed to this thread so far, i wanted to echo Omei's thanks as you've helped us make numerous improvements. Over the next week, you'll start to see the puzzle actually rolled out in the game.

I've put up a short blog post here   http://www.eternagame.org/web/blog/8065985/ guiding players to this particular thread to collate comments/bugs about the puzzle and other aspects of the rollout like the text & video describing the puzzle, banners, etc. 
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
OK, all the projects are now accepting submissions, with a per-puzzle limit of 150 designs per player. If you do discover any issues with a puzzle, here is a good place to post them. 

Go to it! :-)
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes


I can't submit more than 3.
I should point out I was submitting solutions when the limit was 3. But clearing my browser history and deleting and reuploading new solutions hasn't fixed this since the new limit came in.
It's the same across all puzzles, even ones I hadn't posted a solution too. And looking at the puzzle browser for the Control On puzzle, it seems nobody else is submitting more than 3, maybe the new limit isn't activated? http://www.eternagame.org/game/browse/8047255/
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Hm.  In your list of submissions, does it say that the limit is 150?

Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
In any case, I've alerted Nando to the issue.
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
Yes, like that, it says the limit is 150 but isn't allowing more than 3. I'm sure it'll be fixed soon.
Photo of whbob

whbob

  • 190 Posts
  • 57 Reply Likes
13:00 EST: submitted 6 solutions with no problem.  Went back & opened them for review and confirmed acceptance.  Control-ON.  Thanks.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Thanks for the report, @whbob.

Can anyone else help us pin this down by posting whether they can or can't submit more than 3?  (I can't test for myself, because I've been given bot privileges.)
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
I could submit a 4th solution just there, so it might be resolved now
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I'm experiencing something strange in the Tetracyclin lab. When I submit my design, it is stable in one of the engines. However when I reopen the design to view it, I can't make it stable in any engines. However if I copy the sequence from one of the designs and post it into the puzzle for new designing, it turns stable again.

Here is an example. Take this design:

https://www.eternagame.org/game/browse/8047752/?filter1_arg2=8070926&filter1=Id&filter1_arg1...

When I open the design and swap among the engines, none of the versions are stable.



Here is the sequence:
GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACUAAAACAUACCAGCAUGCGAAAGCAUGCAUAAAUCCUCACAUGAGGAUCACCCAUGUGGAGAGGUGAAGAAUACGACCACCUAGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

However if I paste the same sequence into the lab design page, it is stable.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I'm having the same problem for this lab solve: https://www.eternagame.org/game/browse/8047744/?filter1_arg1=8071271&filter1_arg2=8071271&fi...

This seems to happen in only some labs and not all.
Photo of Astromon

Astromon

  • 182 Posts
  • 23 Reply Likes
I have been looking at many designs yesterday and i noticed too some of your had odd constraints that were not met.
<img src="https://image.prntscr.com/image/CwYkpNLUSuSgbZNFbv7_qA.png" height="500" width="600">
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Thx Astromon!
Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
Could it be related to poll's problem below?
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@Eli Nando has now fixed the issue that we think was causing your problem of the folding engines giving different predictions in different contexts.  Please repost if you still see something fishy.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Use #Hashtags to make design clusters


I wish to recycle a fine idea of Nandos as a way for us to make the most from our slots.

Using Hashtags to Improve Lab Collaboration and Experimentation

By giving your design a # + a keyword, you will make it way easier to pull out your group of designs later and compare results.

Word of advice. Stick the hashtag in the design title. The description field usually doesn't make it to the spreadsheet. And from experience I know that we always get the spreadsheet first and the data upload to the lab is regularly much slower.


Experiments

This round we have so many slots that there will be plenty of space for doing experiments.

  • You could do groups of 10 or 20 designs testing a specific idea. I like to call this design clusters or sibling designs. With a hashtag you could mark them as belonging together. 

  • You could test a specific idea for a group of designs and then do a control group without that feature for similar amount of designs. 
This is called science ;)


Some ideas for what to do

I have already challenged you guys to make designs with double and triple aptamers. Plus seeing to that they are symmetric in both states :)


For more ideas you can see what I have tested out in last round.

Ideas for Hashtag use
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Eli, can you elaborate on the specific symmetry you are referring to here?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Omei, I see what happened.

This was one of my designs that looked good in the engine when I posted it, but got unstable.

I can see the design as I intended it when I open this lab page

https://www.eternagame.org/game/puzzle/8038691/

And paste in my sequence:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGUAGGAUAUGUAGGAUAUUCCUAAAAUAAAUUCCUACAUGAGGAUCACCCAUGUUCGCAAUAAUGGAAGAAGGACAGAAGGACGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

I shot an image as proof.



So basically it's like the switching area in the two states, doing a cross over with each other. Just like in the blueprint idea. It is doing the exact same Origamy style fold, that I see pop up again and again in the riboswitch on a chip labs. In particular in Same State designs.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
@Eli I'm not clear on what you discovered.  That you were mistaken, or that you have a reproducible scenario that demonstrates a bug?  If the latter, could you give the steps to reproduce it?
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Bug report

1) http://www.eternagame.org/game/browse/8038691/?filter1_arg1=8069544&filter1_arg2=8069544&fil...

Design is unstable when opened through lab. Unstable in all 3 engines.


2) I copy out the sequence from there:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUACGUAGGAUAUGUAGGAUAUUCCUAAAAUAAAUUCCUACAUGAGGAUCACCCAUGUUCGCAAUAAUGGAAGAAGGACAGAAGGACGUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


3) I open the lab from the FMN lab overview page. Link to the lab:

https://www.eternagame.org/game/puzzle/8038691/


4) I paste in the sequence in the puzzle.


5) The puzzle is suddenly stable in Vienna and Vienna2

Specification for stable version



6) The specifications like MeltPlot don't match up for the stable and unstable version. This may be related to what Poll na gColm and MasterStormer has brought up too.

Specification for unstable version


 
(Edited)
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 966 Posts
  • 304 Reply Likes
Thanks !  Nando thinks he has the issue identified.  He wrote

I think I know what's going on: for OpenTB, we introduced a new feature for faster browsing, a server-side folding cache. Given that NuPACK was the only engine available, results were consistent. Now however, we're using 3 engines, and players browsing designs with different engines are "polluting" the server-side cache by submitting folding information with a different engine than the one that was used to create the designs.

I need a bit of time to find a proper fix. It's late here, but I'll work on it first thing tomorrow morning. @omei can you please inform the players to be a bit patient, I'll have this problem fixed within 24 hours, thanks.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Omei, this is awesome news. :) Please send a big thx on to Nando!

Thx Poll na gColm and MasterStormer - your specification images and discussion got me shooting mine also.

I need sleep also - now actually. :)
(Edited)
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes


Player Zama also pointed out to me that data in the specs and broswer tables are not correlating (melting points and free energy from what I've checked). Apparently it's not for all puzzles, but it is for a lot. What do experts think of this?
Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
It's probably that the folding engine in the specs screen (99% sure it's the one you choose in the puzzle) isn't the same as in the lab/data browser. Can you test for the 2 other folding engines?
Also, if you substruct the red part (I think you need to add it, but if I'm wrong it would work), the puzzle energy seems to be the same as the specs one: -56.89-26.80=-83.69~=-83.9, although I doubt it would round -83.7 to -83.9, so maybe I just picked the pair of nubmers that looks like it could match in the not-so-small group that doesn't work? not sure.
(Edited)
Photo of MasterStormer

MasterStormer

  • 81 Posts
  • 15 Reply Likes
After reading a bit, I think it's the same as Eli's problem above (not directly above, the one after)
Photo of Poll na gColm

Poll na gColm

  • 26 Posts
  • 20 Reply Likes
The engines give NuPACK: -56.48(26.80), -64.79(26.80); Vienna2: -53.68(26.80), -64.39(26.80). Don't know how the browser table is coming up with -77.41 kcal. And there's 20 degrees difference in the melting points.
Now also the pairing probability plot goes missing when I change engine, and the melt plot remains the same for all engines.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Even More symmetry...

Continuation of my symmetry musings above. Omei was right, I was both doing bug reporting and speculating about symmetry at the same time.

"So basically it's like the switching area in the two states, doing a cross over with each other. Just like in the blueprint idea. It is doing the exact same Origamy style fold, that I see pop up again and again in the riboswitch on a chip labs. In particular in Same State designs."

However as our design space get bigger it might not be the most effective doing a two stem cross over with 4 strands swapping partner between the two states.


3-way Stem Switch

There are other ways to achieve even more switch symmetry across axes. I have had fun doing a 3 stem switch, where 6 strands swap partner between two states.


https://drive.google.com/open?id=0BxJGPGrJ3fkKU0NPelhTVTNEQnc

This one still builds on repeat sequences that seems to be particularly helpful in making a switch happen. Stretches of pyrimidines (C and U) pairing with stretches of purine. (G and A)


4-way Stem Switch

I did try out make a 4 stem swap where all 4 stems were to swap partner with its neighbour.


https://drive.google.com/open?id=0BxJGPGrJ3fkKU0NPelhTVTNEQnc


Symmetry challenge

So far I have had no luck. Or rather, I found my 3-way switch while attepmting a 4-way switch. Perhaps one of you guys will have better luck?

Here are a few of my attempts:

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCCUCAAAAGGAGGAAACCUCUACACAUGAGGAUCACCCAUGUGAAGGUGAAAAUCUCAAAUGGGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU

GACGCAUAAAGAUGAGACGCGUUUGAGAGCUAGACCCUUGGCAGCCUCUAAAAGAGGAAACCUUUAAACAUGAGGAUCACCCAUGUGAGGAUGAAACCCUCUAAUGGGAUACCAGUCUAGCAAGUUCAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU


I suspect it will be possible, but what would be helpful for more axis symmetry switches to happen is if the repeat sequences are of a more cleaner anagram nature. That way a switch will become easier, even with more switching elements.

So more anagramic switch elements wanted! :)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Shared Experiments - Hypothesis Busters :)

Last Riboswitch lab round (101) was a training round for doing experiments and joining them together by hashtags (#). We did so as individual players and smaller groups, but not so much as a community.


However if more players join the same #hashtag experiments - we have a far better shot at getting enough data to either confirm or bust a hypothesis.

As for inspiration I volunteer my own plan for experimentation this round. These are things I think of as worthy experiments. I leave it open for you to join or make a variant should you wish.


For details on experiments on the experiment list, see: Hashtag Experiments

There are many more interesting things to test. Please put up your own #hashtag experiments and describe them in the forum for others to join.  


Help each other test hypothesis - join each other's experiments


Thx to Mat and Omei for discussion




20 Experiments worth doing

Example of experiment done with hashtags


Control group and group with the tested feature. The idea is to take a set of different designs eg Group 1 and then do a Group 2 with identical designs, except they have GU’s added. Perhaps even put Group 1 and Group 2 in the design description to distinguis that a set of designs belongs together. Or G1 and G2.


GU in the switching area

Group 1: Designs with no GU in the switching area #GU-

Group 2: Designs identical to group 1, but with added GU #GU+





Seriously Fun Experiments


  • #MirrorAptamer    
  • #DoubleAptamer
  • #TripleAptamer
  • #AroundMS2Mutations
  • #DoubleMS2
  • #3-way
  • #4-way
  • #BlueprintAddition


Exclusion Lab Experiments


  • Shared Turnoff Sequence
  • GU in the switching area
  • MS2 position in relation to aptamer


Same State Lab Experiments
  • MS2 position in relation to aptamer


General experiments for Exclusion and Same State Labs

  • Different length of the aptamer gate
  • Different number of static stems
  • Static Stem or no static stem
  • Long static stem - with or without GU
  • Alternative MS2
  • Mismatches around switching stems
  • Mismatches in hairpin loop in switching stem
  • Patterns for closing basepairs in the aptamers


Past forum posts on related labs

See past Riboswitch Forum posts for inspiration for experiments to do and hypothesis to test.


FMN/MS2 Riboswitch Structure discussion

Blueprint of the MS2 and FMN Riboswitch

Switch Scores for EteRNA Switch Puzzles

Round 98 NG Switches Lab Discussion

Round 97 Riboswitch Lab Discussion


The lab portion we are to solve are either in family with or identical to some of the labs discussed in these forum posts.

(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
CRISPR Experiment - Round 1

I have been wondering about something in relation to the CRISPR experiment. Turned out Omei had too. I hereby share our conversation from saturday, as I think this is something we all should know.

eli: By the way, there is one thing I don't understand. We are switching on and off the riboswitch region that we add. But we are doing nothing to the CRISPR part. I mean is it expected that the conformational changes in the switch bubble are to effect the binding of the CRISPR thingy? I don't see us switching on or off the CRISPR thingy by our riboswitch addition.

omei: Re the puzzles, I had that same question.

eli: It has been bugging me...

omei: It turns out the CRISPR guide RNA refers to the whole RNA, not just the part that binds to the DNA.

eli: Interesting - so the off switch of the riboswitch part could really end up turning the CRISPR on. ;)
Perhaps even skewing of the switch bubble may turn out helpful - biggest possible move

omei: I think this first round of puzzles is about testing the experimental pipeline as much doing something that is clinically relevant by itself..

eli: Ok. From what I read in the lab description it seems it have been bugging the scientists too.

"We hope the resulting data will let us figure out detailed rules for maximally activating and shutting down CRISPR."

So okay it isn't some big flaw in the lab set up - which I was kind of worried about

omei: It's planned, I think, but not I'm not clear on the full path.  Rhiju is talking about doing the
experiments in vivo, using cell sorting.  This would give us even more capacity than the array experiments.  View these labs as a first step, not the final result.
Photo of Astromon

Astromon

  • 182 Posts
  • 23 Reply Likes
I guess we are learning about what it will take to learn about how to have our RNA work with CRISPR. Thanks for this information!

"We hope the resulting data will let us figure out detailed rules for maximally activating and shutting down CRISPR." This part of the message from them led mt to try and put more gc near the ms2 switching area thinking maybe to help keep it OFF until needed to switch on well maybe on to off now that I read this conversation. 
I can go Back to the OFF lab I'm referring to and make a set of those types and a set of heavy gu and a set of a balance of both. Thanks!
(Edited)
Photo of yulan

yulan

  • 17 Posts
  • 0 Reply Likes
This might already be known, I think I read this somewhere but now I cant find it...:
When I switch engines halfway through designing and then switch back  the undo stack is empty, this means I cant undo changes that made the design unstable... not very practical...