Possible error in setting up a challenge puzzle.

  • 1
  • Problem
  • Updated 9 years ago
  • Solved
The tally of three-in-a-row "red" is wrong in the puzzle: http://eterna.cmu.edu/puzzle/Challeng...

The sequence; AGCUAGUAGAUGUGGUGUAUUAAUGUGUAGAUUAGAGUUAGUUACAAAAAGGGUAGUAAAAAAGGUUGAAGUCUGACGCUACGAGCGCGAAAAGGUCAAAACUAUGCUAAGUCAGAUUAAAAGUAAAAACAGAUUUAAAAAAAAGGUUAUGUUAAUAUAUGGUUAGAUAAGGUAAAAAGAAGUUGAUUAGUGUAAGAGUGCGGAUGAACGAUUGAAAAAUUGAUUGAAAAUGAAAUGAUUGAUAUUGGAUAAUAUGUAUAAAUAUUAUGUUAAUAGGUA has only one triplet, yet it faults the constraint. Thanks.
Photo of Frank Dull

Frank Dull

  • 7 Posts
  • 3 Reply Likes
  • confused.

Posted 9 years ago

  • 1
Photo of Jeehyung Lee

Jeehyung Lee, Alum

  • 708 Posts
  • 94 Reply Likes
Hi Frank

the constraint actually means you are not allowed to have any consecutive 3Gs at all. The number in the constraint box indicates the current max length of consecutive Gs, not how many consecutive 3Gs you have.
Photo of Adrien Treuille

Adrien Treuille, Alum

  • 243 Posts
  • 33 Reply Likes
Hmmm. Jee. I must say, that this is confusing from the UI perspective.
Photo of Frank Dull

Frank Dull

  • 7 Posts
  • 3 Reply Likes
I understand my confusion. If only there were a pictogram that represented "your-score/maximum" that everyone understood...