Report problems for the new UI update

  • 2
  • Problem
  • Updated 6 years ago
I will like to start a page that specifically collects bugs and problems related to the new user interface.

Are some of the game functions broken?

This page is meant as a help to collect current problems so we can get them identified as fast as possible.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes

Posted 6 years ago

  • 2
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
The biggest problem I have encountered so far is that the slider to the right side of the screen means I will have to scroll down each time I want to use the bottom slider. I will like the Lab picture to fit the screen. As is this gives a lot of extra moving around and extra clicking.



I can’t see the bottom of the datafield, unless I scroll with the whole page slider. I also need to get to the bottom slider to move around things to my liking. Like to get the scoring in the right order. It will be better if there is only one scrolling option - that in the data field. It will save a lot of clicking and scrolling in the length.

New UI


Before
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
I agree with Eli. This is the single biggest issue I've found.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
I'll add that there's a general problem with the new UI in that it seems to have been designed and tested by developers with very large monitors. On a large enough monitor and a large enough resolution graphics card, there wouldn't be so much scrolling needed. But I doubt whether that is typical for an Eterna player.

You could look at your Google Analytics and see what what range of screen resolutions people have, and then target the UI design to be easily usable for lower mid-range and up.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
I find the new view options confusing. It is much more intuitive changing when it is visualized with arrows and x for delete. It will also allow you to have more options closer together. But good thing that the new version isn’t transparent. That makes things easier to see.

New UI


The version I prefer, except for the transparancy
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Another huge advantage with this version is that I can temporarily delete the columns that I don't need. Having only the columns I need in the window, also means less scrolling. For voting I use some columns and for lab, I use others. I usually don't need the Vote and My votes columns, when I do lab analysis and when voting I don't need ID, Synthesized or synthesized score. When I look for something specific, I sometimes make a lot of columns away, as I don't need them and they are just in the way. Having fewer columns up and just the ones I need, also makes it easier moving them around to get them closer to those I want. The delete option makes things easier.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Base numbers out of synth

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
When I enter a lab, I usually start sorting the designs after score. When I then afterwards set SHAPE data to continuous, the page loads again and reset the scores of the designs to disordered.

I will like the new UI to remember my global lab SHAPE preference, as the old UI did. So each time I enter a lab it is set to continuous colors and so the score of the designs is set in the order I wish for.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
The exact same breaking of order of the scores happens when I want to switch from SHAPE colors to base colors. It re-reads the page and scrambles the scores. It also lands me a different place on the page so I have to start scrolling again + sorting the score again.

When analysing I often shift between SHAPE colors and base colors. With this option, I could toggle painfree between them.



Only thing changing was colors, not position, nor score.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
The new UI works seems to work like a google browsing session. Usually when I have finished what I want to do in a lab, I pick the browser option, to get back to the lab list overview, to pick the next lab on the list or what else I plan to do.



But now, as the game remembers all the things I have been doing while in the lab and it works like a browser session, I have to click through all the pages with the things I did, to get to the list with the labs, before I can get to another lab again.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
I really miss the horisontal lines for each 5 line, in the new UI. Both between the sequences, but also between the data itself. When I make spreadsheats, I'm sometimes interested in the numbers of designs that eg score above 90% or I'm interested in how many designs have a certain amount of GU pairs. Having the lines for each five sequence, makes it real fast to count, where as if they are missing I am back to having to count each design individually.

Photo of TomoeUzumaki

TomoeUzumaki

  • 2 Posts
  • 1 Reply Like
Today when I was attempting to vote for a lab, using the new interface, I noticed that there was no voting option. You can vote in the old interface, but not in this one. When you click on a design, this is what comes up:
Photo of dianaBK

dianaBK, Alum

  • 29 Posts
  • 2 Reply Likes
Hi Eli and Tomoe,

Thanks for sharing issues.

Eli - I'll archive current issues, then email you. Let's talk about whether they are resolved or not.

Tomoe - Actually, new lab browser is not released for "player proposed lab", so we blocked "vote" function for a while. We will launch it in this week. Could you wait for it until then? Sorry for inconvenience.

Best,
Diana
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Thx, Diana. Got it.
Photo of TomoeUzumaki

TomoeUzumaki

  • 2 Posts
  • 1 Reply Like
Diana, how do I get to the old lab interface??
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Hi Tomoe! You can get to the old lab interface by either clicking these symbols.



Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Ok, this is not working anymore. Now the way to the old UI, is this way:

Photo of wateronthemoon

wateronthemoon

  • 8 Posts
  • 3 Reply Likes
Lab is now very cumbersome to navigate those easier last mods and votes. Lab deadline is tomorrow! Should be extended.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
I can't go back through the browser when I see this screen. It gets stuck. Usually I could get back to the lab list that way. Now I have to pick lab from the active labs menu.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Base numbers are out of synch in a new way.

Photo of wateronthemoon

wateronthemoon

  • 8 Posts
  • 3 Reply Likes
Also, when you finish with a lab and hit the back button, instead of taking you to the whole list of labs, it takes you to the color chart and no back button there. You have to select labs from top menu all over again. Then scroll down to find next lab. The whole situation is very time consuming. Finding myself doing sight-unseen voting just to meet deadline. Also lazy mods.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Yes, I now see what Wateronthemoon says. I choosed the Old lab browser. But all the time I get sent back to the new and has to start all over. It is very tedious. Here is what happens in step:

1: I found the design I want to look at. I want to go back to the design list with the person button as usual.



2. Now a new window opens and forces me back in the new UI.

Photo of Hyphema

Hyphema

  • 91 Posts
  • 25 Reply Likes
I have discovered two things.

1). when you click on the lab design you get to see the "target shape" which is colored supposedly representing the proper nucleotides but it seems that the colors are not correct.

2). when using the "my votes" column it only works when you are currently voting. If you made three votes and decided to go back later to finish voting the previous three votes are not shown.
Photo of dianaBK

dianaBK, Alum

  • 29 Posts
  • 2 Reply Likes
Hi Hyphema,

Thanks for reporting.
With respect to first issue, it would be helpful if you could give us some links!

Thanks,
Diana
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
COMMENTS ON THE NEXT/PREVIEW INTERFACE

I think this interface will work fine for a preview. But we need to be able to call it when we need it and not have it pop up each time we click a design and have it get in the way.



Though it is meant for short cut to make voting easier, it doesn't work as such. (All honor for the intention) I'm loosing a lot of information, like the ability to see estimate mode, if the design is folding in the energy model, temperature, dotplot, free energy and score. Worst of all I can't see continuous SHAPE data - as I will also want this one click way to see and analyze designs that we have results for.

I want the next/previous button to be in the design itself, just as Mat suggested with his image mockups. I want the full screen for viewing and I will want the fine game view of the design.

SUGGESTIONS FOR A BETTER UI

Quote by Zanna: As long as I can see everything with one click, Im happy :P

I have made a few crude pics to demonstrate what I mean.

Voting and designing interface.


Lab result interface


The above pics are rip offs from Mat’s mockups.

I wish that one could choose what modules one want shown. There could be melt module, dot module, temp module, author/title module. So one get exactly what one needs and nothing more.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
I have added chat log from yesterday and today as they hold useful suggestions to what could be improved in the new UI and how.

(8 Nov 2013)
Brourd: Wateronthemoon, are you still on? [1:06 AM]
RedSpah: apparently no [1:07 AM]
RedSpah: hi Brourd [1:07 AM]
Brourd: I was just going to say, that they have the ability to vote in the new browser [1:08 AM]
Brourd: albeit, in a relatively awkward place. [1:08 AM]
Zanna: but you can't view it first from there [1:09 AM]
Zanna: I just get blue screen [1:10 AM]
Brourd: in the new browser, you should get the list of designs [1:10 AM]
Zanna: yes, I do [1:10 AM]
Brourd: http://prntscr.com/22ulxg [1:11 AM]
Brourd: then, when you click on a design [1:11 AM]
Brourd: http://prntscr.com/22um25 [1:11 AM]
Brourd: this should pop up [1:11 AM]
Brourd: then [1:11 AM]
Brourd: http://prntscr.com/22um7o [1:12 AM]
Brourd: scroll down, and you should see vote at the bottom [1:12 AM]
Zanna: yes, you can't see the dot plot and melt [1:12 AM]
Brourd: What do I look like, a magician? :) [1:13 AM]
Zanna: lol [1:13 AM]
Brourd: Actually, I think that would be an interesting way to do things. [1:13 AM]
Zanna: it was the dot plot I was really wanting to see [1:13 AM]
Brourd: Yeah, yeah ;P [1:13 AM]
steven123505: lol [1:13 AM]
steven123505: hey B [1:13 AM]
Brourd: what we could maybe lobby for [1:14 AM]
Zanna: lobby for what? [1:14 AM]
Zanna: exactly? [1:14 AM]
Brourd: http://prntscr.com/22umxm [1:15 AM]
Brourd: fill in this empty space with the dot and melt plot [1:15 AM]
Brourd: If they can anyway. [1:15 AM]
Zanna: ah [1:16 AM]
Zanna: good idea [1:16 AM]
Brourd: Maybe with better dot and melt plots ;) [1:16 AM]
Zanna: but another problem... [1:16 AM]
Brourd: We can move vote button up higher [1:17 AM]
Zanna: I can't see how many votes the design already has from there [1:17 AM]
Zanna: need to see that also [1:17 AM]
Brourd: We could maybe also try to do that :P [1:17 AM]
Brourd: What do you think zanna? [1:17 AM]
Brourd: What that be good with you :) [1:17 AM]
Zanna: as long as I can see everything with one click, Im happy :P [1:18 AM]

(9 Nov 2013)
Hyphema: it seems much harder to vote on labs [1:13 AM]
steven123505: yeah [1:14 AM]
steven123505: but voting for my labs is easier ;D [1:15 AM]
steven123505: you should try it [1:15 AM]
Hyphema: also. when you click on a design to look at....the "target shape" shown has what appears to be a colored structure representing all the nt's used but the colors do not make any sense [1:15 AM]
Hyphema: : D [1:15 AM]
steven123505: didn't notice that [1:15 AM]
mat747: i agree with hyphema [1:17 AM]
Hyphema: i really like the idea [1:18 AM]
Hyphema: just the execution is bit off. [1:18 AM]
mat747: it would be great if we had "prev" and "next" in the lab design screen [3:50 PM]
steven123505: agreed [3:51 PM]
Eli Fisker: Yes, I would want it in the design itself [3:51 PM]
mat747: https://getsatisfaction.com/eternagam... [3:51 PM]
Eli Fisker: It will both look better, but we wouldn't lose all the information we are now losing [3:52 PM]
Eli Fisker: Like melt temp, Total energy, continuous shape data and yada yada [3:52 PM]
Eli Fisker: I will like something like this: [3:53 PM]
Eli Fisker: https://getsatisfaction.com/eternagam... [3:53 PM]
Eli Fisker: To stay in the design and still be able to click next [3:53 PM]
Eli Fisker: or previous [3:53 PM]
Eli Fisker: but still get all the information [3:54 PM]
Eli Fisker: and preferable have both shape data and base colored shape beside each other [3:54 PM]
Eli Fisker: And then I could use the lab list to narrow down what designs I want to look through. So I don't have to go through all by default, but can carefully pre-pick which I want to view. From things like energy range, number of GC-pairs and so on. [3:56 PM]
Photo of Zanna

Zanna

  • 23 Posts
  • 4 Reply Likes
I post a problem, but looks like this is a better place for it.

https://getsatisfaction.com/eternagam...

^ link to my post.
Photo of wateronthemoon

wateronthemoon

  • 8 Posts
  • 3 Reply Likes
Zanna--I really like your graphic above showing dotplot and melt nice and big next to the design. That's just what i'd like, so you don't have to keep enlarging it to check each time you make a change.

In the new list (i keep call it "color chart") i noticed order is by number of votes, with most votes at the top. Not sure i like this.

Also noticed, like Hyphema, that in the new popup screen showing the shape colors are off--like where tetraloop is all locked yellow, this shows a green or a blue in the middle.

Anyway, glad we got an extension--makes my inner (and outer) procrastinator happy.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
In the 'Previous labs' tab, I'd really like a new sorting option to be 'by Cloud Lab Round', and it should be the default one in my humble opinion.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
I very much agree. When trying to find the latest labs, they are scattered all over the latest pages, depending on their proposal date, which can be a while back.
Photo of machinelves

machinelves

  • 155 Posts
  • 23 Reply Likes
Many thanks, everybody! I have drawn issues from this thread, and in-game chats to create a specification we can present at this Wednesday's dev chat 2013.11.13 (6pm eastern).

https://getsatisfaction.com/eternagam...
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 483 Reply Likes
Fine piece of work you did there. Thx!
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
Script search field
An FYI
search field is buggy.
search by JR gives one page but I have more than one page.
search by jandersonlee give nothing but when i remove name and hit enter his
list come up. seems no way to reset so have to reload list from start

any better place to list these other than forum?
not really "forum worthy" but no other place to post.
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
Lib.energyOfStruct(seq.join(''), structure)
Just an FYI - these two structures throw an error when run through the
above function:

ACACGUGGCUGCAAAGUGGACUGCGUGCAGGUGGGUGCAAAGUGCACUGCCUGGCAAAGCGCACGUGCAAAGUGCGGGGCAAGCGGGCAG
.((((..((..(...)..).)..))))((((..((..(...)..).)..))))((...((((.((..(...)..))..))..))..)).
AGGGAAAAACCGCGGGCGGGGCGAAAAAGGCCGGGCGGCCCGAAAAAGGAG
.((......))((.(.(.((.(......).)).).).))((......)).

I just trap the error so no big deal.
It works for all other.
Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
I have been wondering about why there was a tendency for the lowest scoring data to most often be those who were pushed and spread out compared to the rest of the data. I think I know why. It is due to the added red frame from the error data. It works as an extra size add on, where it should be fit to the frame of the standard size of the letter box.

Photo of Eli Fisker

Eli Fisker

  • 2222 Posts
  • 484 Reply Likes
Failed designs land on top when I sort after score and rank the designs from highest score and down.

Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
browser back button not working in previous labs
You have a lab list, a lab, and a lab design.
browser back button between lab list and a lab only works if you don't view a lab design.
if a lab design is viewed you get stuck in a loop between the lab and the lab design.
Photo of JR

JR

  • 240 Posts
  • 20 Reply Likes
structure is found in lab info tab and sequence is found in review tab.
difficult to get from one to other to get both
(unless I am missing it in lab design list page)