Select, Copy, Paste

  • 1
  • Idea
  • Updated 2 months ago
It would be really cool to selectively copy and paste selected regions of the sequence string. For example, if I had GGGGAAAAAACCCCUUUUUU, it would be cool to just select an arbitrary bit of the sequence and copy that, such as GAAAAAAC in the above sequence.
Photo of Brourd

Brourd

  • 450 Posts
  • 82 Reply Likes

Posted 2 months ago

  • 1
Photo of Andrew Kaechele

Andrew Kaechele

  • 85 Posts
  • 27 Reply Likes
In the meantime, this script works.
Copy/Delete/ReplaceĀ Alpha
https://eternagame.org/web/script/7328635/