Switch puzzle idea

  • 1
  • Idea
  • Updated 7 years ago
  • Implemented
I have an idea for a switch puzzle, I don't know if you've tried this before or not: can there be a fixed part? I've made a simple one I call Simple Key, here's the shape and sequence:

.......(((((.....(((((......((((....)))).....))))).....)))))........................
GGAAAUACCUCUAAAAUUCGGAAGGAUAUUAUGAAAAUAAGAAGGUCUGAACCUAAGAGGAGGUAAAGAAACAACAACAACAAC

This is the bound shape notation with the FMN loop. The sequence will form bonds where it's supposed to (and the FMN loop), but will misfold into a stronger shape instead with a multiloop where the bonding site is. Here's the misfold shape (unbound target):

.....(((((((...((((....)))).((((....))))..((((....))))....)))))))...................

Obviously you can refine the shape as you see fit, the idea is to have a part that's not shifting, and the bonding site is an ideal splitting spot.
Photo of drake178

drake178

  • 44 Posts
  • 5 Reply Likes

Posted 7 years ago

  • 1
Photo of Jeehyung Lee

Jeehyung Lee, Alum

  • 708 Posts
  • 94 Reply Likes
Hi drake178,

This looks like a great puzzle - can we make it as one of the switch challenge?

Eterna team
Photo of drake178

drake178

  • 44 Posts
  • 5 Reply Likes
That was the intention, yes, but I thought you might want to tweak it. Thanks! :D

Edit: I looked again at that solution and it should probably not work because it has a loop opening up with an A-U, which is something I've seen happen in switches (bound form), but I don't yet know why it happens. Anyway, I re-solved it with a slightly different sequence:


GGAAAUACCUCUAAAAUUCGCUAGGAUAUUAUGAAAAUAAGAAGGAGUGAUCCUAAGAGGAGGUAAAGAAACAACAACAACAAC
Photo of drake178

drake178

  • 44 Posts
  • 5 Reply Likes
There's at least one thing you'll have to tweak, the hook needs to be 1 base longer because right now base #65 will be locked in the hook but it's also in a pair in the unbound shape.