The TB Challenge: How should we select A, B and C segments from the larger possibilities?

  • 3
  • Question
  • Updated 7 months ago
  • Answered
The Khatri lab at Stanford has identified three RNA molecules that, when present in human blood in certain ratios, are highly indicative of active tuberculosis.  Designing a riboswitch that selective triggers phosphorescence in the presence of the proper ratios is the focus of the Eterna TB challenge.

As players, we have the opportunity not only to design the riboswitch, but also to help choose the specific input and output sequences (A, B and C) that the switch will be sensing. This additional choice needs to be made for two reasons:
  1. The RNA sequences that were identified are actually 50 bases long, whereas all our past experience has been with shorter segments, and
  2. We can choose to target either the RNA sequences or their complementary DNA sequences.
There has been some internal discussion about this, and there are many possible criteria for making the choice, but no obviously correct answers. So Rhiju has decided to open up the discussion to include all players.

To get things started, Wuami will soon be following up with a post about the pros and cons of targeting the DNA rather than the RNA.  I'll also follow up with a summary of my initial thoughts on choosing subsequences to increase the possibilities for designing switches with high fold changes.  

We'll see where it goes from there!
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
  • excited

Posted 4 years ago

  • 3
Photo of wuami

wuami, Researcher

  • 22 Posts
  • 6 Reply Likes
Hi all -

The analyses that the Khatri lab performed are from microarray experiments with data deposited in the Gene Expression Omnibus.  Typically, the RNA from blood samples is reverse transcribed into cDNA, which is then spotted on the microarray chip.  This chip contains DNA probes that bind to the cDNA.  The DNA probe sequences for the 3 targets are:

[A] GCAGGAACAACAGATGCAGGAACAGGCTGCACAGCTCAGCACAACATTCC
[B] CCATGGTGATGGATGGTTTGGAAAGGGAATGTTGGTGCCTTTTGTGCCAC
[C] ATTACTGTACATAGAGAGACAGGTGGGCATTTTTGGGCTACCTGGTTCGT

These are the same as the RNA sequences in the blood (with T->U of course), but the cDNA sequences (those actually detected in the experiments) are the reverse complements:

[A] GGAATGTTGTGCTGAGCTGTGCAGCCTGTTCCTGCATCTGTTGTTCCTGC
[B] GTGGCACAAAAGGCACCAACATTCCCTTTCCAAACCATCCATCACCATGG
[C] ACGAACCAGGTAGCCCAAAAATGCCCACCTGTCTCTCTATGTACAGTAAT

You can read more about the details of the how the data was collected in the following papers.  Unfortunately, one or two of them are not open access but the vast majority should be.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3492754/
http://www.nature.com/gene/journal/v12/n1/full/gene201051a.html
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0026938
http://jid.oxfordjournals.org/content/207/1/18.long
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3356621/
http://journals.plos.org/plosmedicine/article?id=10.1371/journal.pmed.1001538
http://www.nejm.org/doi/full/10.1056/NEJMoa1303657
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0070630
http://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-14-74
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0045839
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4515549/
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4734838/
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 968 Posts
  • 304 Reply Likes
@wuami: I've realized that I'm not clear on the implications of targeting the reverse complement sequences instead of the sequences themselves. If we did, would the eventual diagnostic still be submitting RNA inputs to our RNA design(s)?  Or would it be submitting cDNA as switch inputs to our RNA switches? If the latter, is there experience to tell us how much different these DNA/RNA bindings are compared to the RNA/RNA bindings we're developing with?  If the former, what would the process be for generating the input RNA?

Perhaps my more fundamental question is "What kind of knowledge do we, as Eterna players, have that might contribute to making this decision?"
Photo of wuami

wuami, Researcher

  • 22 Posts
  • 6 Reply Likes
@omei: We're in the process of working with the MIT Little Devices lab to figure out the exact setup for the final diagnostic device.  This will help us figure out whether we should be targeting the probe sequence or the RC.  If it's RCs, it will be cDNAs reverse transcribed from the RNA from blood.  There's plenty of literature on RNA:DNA hybrids out there, e.g. http://pubs.acs.org/doi/abs/10.1021/bi00035a029.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
@wuami: if I understand the paper clearly (thanks for the pointer btw), RNA/DNA hybrids have distinct thermodynamic properties compared to homogenous RNA/RNA and DNA/DNA duplexes. And as far as I know, Nupack doesn't support hybrids, while the Vienna team has an alpha package (2.1.6h) that hasn't made it yet into the master branch (which has now advanced to 2.2.4).

If the choice ends up being cDNA, maybe we should go for full DNA in the Flash simulations (should be doable), using Nupack.

This said, RNA would evidently be more practical. Well, specially for me :D
Joke aside, it seems to me that reverse transcription should be seen as costly, slow and/or complicated, specially for a diagnostic trying to be as cheap and as fast as possible... @wuami: please, when you find a minute to explain, I'm curious as to why this is actually being considered.
Photo of wuami

wuami, Researcher

  • 22 Posts
  • 6 Reply Likes
@nando: cDNA is indeed much trickier than RNA.  The rationale for using cDNA would be that that is what they were actually detecting in the experiments used by Tim et al. to find the expression signature.  I should say I'm not yet convinced that that is the better option.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
Information gleaned in yesterday's meeting: a reverse-transcription step would eventually allow for a selective amplification. In other words, the cDNA products would only be the signals associated with the 3 genes of interest. This would remove the worries about possible interferences from other genes.

I gotta admit: if it's not otherwise too costly or too complicated, that's a nice feature.
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
My suggestion is that extensive chemical mapping analyses be performed on the sequences, which would allow us to identify the regions of the sequences that are exposed to chemical probing and therefore less likely to be participating in significant structures in solution. These may be prime candidates as sequences for binding to our RNA sequences.

As a second option, you could identify the regions of the sequences that have the greatest concentration of guanine and cytosine residues, which allows players to maximize the number of G-C base pairs within the RNA dimer.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
A careful and slow approach of our goal would possibly ask a first question: can we solve the [A]*[B]/[C]^2 problem for some (any?) set of {A,B,C} inputs. In which case, we possibly don't need to worry too much about which sequences we're testing first. The answer to this question alone is not trivial. It requires modelling the problem into an Eterna lab and being able to solve it.

I actually created prototypes on the dev server, using the "old" oligos we're familiar with:
http://nando.eternadev.org/web/puzzle/3391075/
http://nando.eternadev.org/web/puzzle/3391094/
I won't claim that this is the best possible model, but reducing  [A]*[B]/[C]^2 into a 4-states puzzle sounds like a pretty good result already. This said, you'll all rapidly notice the small issue I need to work on: folding engine performance. I've been very busy these past months, so I haven't finalized this part, but I'm working on it, and a workaround should be available pretty soon (don't expect miracles though)


Now, if we're in the business of designing the TB diagnostic, everyone (I mean most players here, I'm pretty sure the scientists are all aware of what I'm gonna say) should at least try to understand what we're dealing with. The RNAs present in plasma/serum (blood) are actually stable, which is quite surprising, since there are ribonucleases (RNA-shredders) present in blood too. So, these RNA strands are most certainly bound and packed with proteins and/or some kind of lipids. A diagnostic device will certainly need to purify the RNA before anything can be done with them.

Then, players also need to understand that the probes listed by Michelle are just that, probes. Let's take the A example: this 50-nt probe is a marker for the presence of a transcript of the human GBP5 gene. The actual mRNA (final, after transcription and splicing) is about 4000 nts long, not just a 50-nt oligo, and that's what the diagnostic device will be dealing with. Coming to Brourd's first idea, we would need the Das Lab to SHAPE-probe the full-length purified mRNA... @DasLab: possible? does it make sense?

Since there will be all sorts of RNAs in the samples, one of the most important thing to pay attention to is to make our test as specific as possible. We don't want the test to get polluted by extraneous signal coming from other genes. Here I'd rather trust someone who actually knows how to BLAST (I don't), for choosing a proper set of targets.


Another factor that shouldn't be forgotten: our tools simulate and predict at 37°C. The diagnostic device and the tested blood will most likely be at room temperature...


Those were my 2+epsilon cents, for now :)
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
For the curious ones, you can see the A marker on http://www.ncbi.nlm.nih.gov/nuccore/NM_001134486
Scroll down and look at the nucleobases numbered 2058 to 2107. Notice that this segment spans the last two exons.
Check for instance http://www.ensembl.org/Homo_sapiens/Transcript/Exons?db=core;g=ENSG00000154451;r=1:89260582-89270863... where you'll see the marker start in exon 10, jump over the intron 10-11, and end in exon 11.
Photo of joy45

joy45

  • 5 Posts
  • 0 Reply Likes
Thanks to the article links and the information already provided here, I feel like I am getting a clearer picture of the overall problem and potential solution.  What I don't get is what exactly would result in the detectable fluorescent signal? I understand the basics of how RNA detection can be accomplished using the MS2 system.  But, I think it would help to know, when attempting to design, whether our design is interfering with or aiding in signal detection.  Or maybe not, I'm new here :)
Photo of JRaiKetchum

JRaiKetchum

  • 1 Post
  • 0 Reply Likes
As nando said, a BLAST homology search needs to be done on the probe sequences first to see if there is any false positives that could occur. It has been a while since I've done a BLAST search using the Wisconsin Package, but I know NCBI's site has BLAST available for use on the web.
Photo of Rocketdog42

Rocketdog42

  • 32 Posts
  • 2 Reply Likes
Why can't you just use the BLAST available on Nando's second reference above?  I'm very new to all this, so it may be a silly question.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 963 Posts
  • 303 Reply Likes
FWIW, It's actually quite easy to do a BLAST search at https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch.  Here's all it took for me to search for the GBP5 tRNA segment I posted below:



(The first input line, consisting of the one character '>', makes the two lines together a valid FASTA formatted sequence).

... and it is pretty straightforward to get the gist of the graphical summary:

BLAST found two sequences that were clearly better matches than any others. Scrolling down the page a bit, we see:



So those two best matches are identified as coming from the GPB5 tRNA.  So far, so good.

But what no one here (including me) has been willing to do is to claim the expertise to draw any definitive conclusions as to what extent the other close-but-not-exact- matches might have down the line when the switches we design are being tested on whole blood.
(Edited)
Photo of joy45

joy45

  • 5 Posts
  • 0 Reply Likes
OK.  I think that I asked the wrong question.  What is going to be labeled and with what? 
Photo of joy45

joy45

  • 5 Posts
  • 0 Reply Likes
Please ignore my previous posts.  They were based on erroneous assumptions.
Photo of Jennifer Pearl

Jennifer Pearl

  • 203 Posts
  • 31 Reply Likes
I'm not a scientist but Nando's comment about getting SHAPE data for the whole 4000nt mRNA makes sense with Brourds comments to be able to know what exactly we are dealing with. Whenever I need to tackle something I first quantify what that is, going to whatever lengths are necessary.  
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
@JRaiKetchum: agreed, and nice to know we have knowledgeable people around for that kind of tasks :)

This said, @wuami: isn't that exactly what you did when you selected the following set:
A (GBP5): ACAGCUCAGCACAACAUUCC
B (DUSP3): GUUGGUGCCUUUUGUGCCAC
C (KLF2): UUUUGGGCUACCUGGUUCGU
?
Photo of wuami

wuami, Researcher

  • 22 Posts
  • 6 Reply Likes
@nando Indeed it is. I ran the probe sequences through BLAST and selected the 20 nt that had the least complementarity to the top hits that did not match the gene of interest.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
That's interesting.  Were they actually better than all the other possible sequences? Or was it a multi-way tie and these were just the ones that happened to get picked?  It seems like an enormous coincidence if, out of the ~30 possible subsequence for each of the three 50-base sequences, the unique best match for all three turned out to be in the same ending position.
Photo of wuami

wuami, Researcher

  • 22 Posts
  • 6 Reply Likes
@omei: For gene C (KLF2), the first 20 would be a reasonable choice too.  Generally, if there's a hit that matches a large chunk in the middle of the sequence, that's going to force your choice to be on one of the ends.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Is it possible for me to recreate the search you did with the web interface at  https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch?  The one I did for my GPB5 proposal (see above) found no exact match in the human genome other than the GPB5 gene itself.  I wouldn't be in the slightest surprised if I didn't perform the best search.  But if I could reproduce yours, I could better understand what we might be giving up in considering other choices.
(Edited)
Photo of wuami

wuami, Researcher

  • 22 Posts
  • 6 Reply Likes
@omei What you did was exactly right.  I just pasted in the full 50 nt probe sequence instead.  You won't find other exact matches, but you will find other genes that match up to 20 nts of the 50.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
My own initial thought for selecting the subsequences was to apply the lessons from the massive amount of switch data we have collected to first try to identify triples of sub-sequences that would be the most amenable to the design of good switches.  With multiple candidate sets, we could then evaluate them from a variety of perspectives, which would include specificity for the RNAs we're looking for (and not others likely to be found in human blood.)

When the subject came up a week or two ago, I wrote down some of my thoughts in Choosing TB segments for the A*B/C squared challenge.  Eli agreed with the premise that the possibilities for achieving high switch scores is dependent on the subsequence we choose, and had his ideas on what is important.  He added his thoughts to the above document.

As far as I know, neither of us has gone back to revisit the question or refine our explanations.  I had hoped to do that before posting this, but that isn't going to happen in the next day or two.  So I'll just throw out my initial suggestions for the triples:

TB A (GBP5):    CAGGAACAGGCUGCACAGCU
TB B (DUSP3): CCAUGGUGAUGGAUGGUUUG
TB C (KLF2):     GAGACAGGUGGGCAUUUUUG
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Thanks, Nando!

In case anyone else might have the same trouble I had in finding where to get the article text, it's the magnifying glass that might be mistaken for one of a set of social media icons. 
 
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Thx, Omei! I had.
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
Far too tired, Omei. However, the general consensus based on the data is that mutations to the helix preceding the MS2 hairpin result in Kd values similar to the wildtype sequence as long as the helix is of sufficient length and is not entirely made of G-C base pairs pr consists of a 4x4 internal loop. However, these experimental sequences had kD values less than 20 nM, indicative of a fairly decent rate of association between the protein and MS2 hairpin.
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
Therefore, you can design the MS2 hairpin however you want to design it.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
A couple days ago, I said:
For one, I strongly doubt that MS2 will be the signal used in the final diagnostic.
Well, as a matter of fact, we're very seriously considering immediately using an alternative in our experiments, because MS2 "kills" the microarray chips very rapidly (and these are a bit costly...). Reporter oligos, as used in the first round of RNA-in RNA-out, look like very good candidates.
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Some more input on the experimental choices we have:

I had previously asked Rhiju whether it was possible to test more than one set of inputs this round. He didn't say no, but it didn't sound very encouraging, since it would increase the time and expense of the experiment.  But today I asked him whether we could consider changing the lengths of the input sequences from the currently proposed 20 bases each, and he said "totally!".
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Good idea, Nando.

Assuming it will be quick, could you make yet another version where the oligo bases aren't locked?  (Or, even better,  is there some back door to unlock specific ones?) The rationale is that if it comes to a question of how susceptible a design is to folding by a specific non-TB RNA sequence, we could see what NUPACK thinks.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
Oligos can't be unlocked, no more than the FMN or TEP molecules can be changed. They're considered as being part of the environment for the experiment, just like other factors like salt concentration and temperature.

The only place where this manipulation could be considered, is in the puzzlemaker, but upgrading it to support oligos is a monumental task that I don't expect to be accomplished any time soon...
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
My take on these new puzzles have to be aiming for a stretch of the single base region, be it tail dangle or loop region. This is enough to get hold of the paired up sequences. I have been avoiding the strongly paired up regions in the hairpins where there is double same turning GC pairs.
Photo of nando

nando, Player Developer

  • 388 Posts
  • 71 Reply Likes
I think it is important to mention that using 50-nts models might cause troubles. You've seen the performance hit on a 4-states puzzles with 4 oligo instances. Adding 4x30 = 120 bases on top of that is most likely going to make the solving intolerably slow, no matter what trick I'll come up with...
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Hi Nando! Point taken. The main thing I'm happy about is that I could pick a better working sequence for the puzzle to make a simpler solve. After that I didn't need the rest of the bases. 
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I'm still trying to wrap my head around the problem.

Nando mentioned that the 50-nt probe is just "a marker for the presence of a transcript of the human GBP5 gene. The actual mRNA (final, after transcription and splicing) is about 4000 nts long, not just a 50-nt oligo, and that's what the diagnostic device will be dealing with."

What I think I hear you say, is that it is not just the 3 different 50 base sequence we have to catch somehow with our switch. But those 50 base sequences each are placed inside a huge ball of messenger RNA.

Or put in other words, I have a real hard time imagining our tiny switch star fighter in between three giant death stars - and much less holding them.

Did I understand this correct, and if so, aren't there any tiny microRNA's we can catch instead?
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
@Rhiju, thx!

I also recall reading in one of the TB papers that Wuami linked, that there were certain small molecules (Neither RNA and DNA) that were also upregulated in TB patients. I don't recall which of the papers and what molecules. But RNA's are great catching stuff with aptamers. Just a thought.

Wishing you and our collaborators luck with figuring what route to take.

And since you mention puzzles, I just want to highlight that Nando has put up a new  puzzle to help us prepare for the coming TB labs.

http://nando.eternadev.org/web/puzzle/3398914/

Everyone who loves switches, please give it a stab.

And there are more TB related puzzles. Those puzzles carrying an A, B and or C in their title.

http://nando.eternadev.org/web/playerpuzzles/?search=nando&switch=checked&sort=date
(Edited)
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
I was thinking today about our Tuberculosis labs and that it would be much easier if the biomarkers we used were microRNA, instead of mRNA's.  

As mentioned earlier, I have been worried about our tiny switch star fighter in between four giant death stars size mRNA's. 

It would be much simpler than dealing with 20 bases from a 60 biomarker from a thousand bases long mRNA, we could instead catch a small 19-24 basepair miRNA sequence - and times 4. I was thinking that this would make things easier working in blood.  

I did a search for microRNA's use as biomarkers and they are started to getting used as such. Here is a paper: 

Extracellular microRNA: a new source of biomarkers

Here are a few excerpts: 

Based on computational prediction, it has been estimated that more than 60% of mammalian mRNAs are targeted by at least one miRNA 

This makes me wonder if there are microRNA's for the 3 biomarkers we have been using for the TB labs?

A (GBP5)
B (DUSP3) 
C (KLF2)

While the majority of miRNAs are found intracellularly, a significant number of miRNAs have been observed outside of cells, including various body fluids [20-24]. These miRNAs are stable and show distinct expression profiles among different fluid types. Given the instability of most RNA molecules in the extracellular environment, the presence and apparent stability of miRNAs here is surprising. Serum and other body fluids are known to contain ribonucleases [25], which suggests that secreted miRNAs are likely packaged in some manner to protect them against RNase digestion. miRNAs could be shielded from degradation by packaging in lipid vesicles, in complexes with RNA-binding proteins, or both [26,27]. 

The ideal biomarker should fit a number of criteria depending on how the biomarker is to be used (Table 1). It should be accessible through non-invasive methods, specific to the disease or pathology of interest, a reliable indication of disease before clinical symptoms appear (early detection), sensitive to changes in the pathology (disease progression or therapeutic response), and easily translatable from model systems to humans. 

... secreted miRNAs have many requisite features of good biomarkers. miRNAs are stable in various bodily fluids, the sequences of most miRNAs are conserved among different species, the expression of some miRNAs is specific to tissues or biological stages, and the level of miRNAs can be easily assessed by various methods, including methods such as polymerase chain reaction (PCR), which allows for signal amplification. The changes of several miRNA levels in plasma, serum, urine, and saliva have already been associated with different diseases [39-59] (Table 2).

At last I will just mention that at least some microRNA's have been identified as biomarkers for childhood tuberculosis: 

Circulating microRNAs as biomarkers for the early diagnosis of childhood tuberculosis infection
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
As long as the mRNA sequences that bind to the substrate are available for binding, it shouldn't be too much of an issue. What I would be more worried about is the possibility for off-target binding between the functional RNA sensor and the mRNA. That may not actually be a bad analysis to make (similar to scoring how well a guide RNA binds to the DNA substrate for CRISPR activity in a full genome) based on the sequence space for the three gene transcripts.
(Edited)
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
Also something that I hadn't thought about is the possibility for alternative splicing of the three genes. It makes me wonder which transcript variants the Khatri lab were detecting in their assay, or if it's a mixture of all transcript splicing variants.
Photo of Brourd

Brourd

  • 452 Posts
  • 82 Reply Likes
I partially redact the first statement. It's possible (and I vaguely recall this from a seminar I attended) that the overall negative charge of the mRNA, which is quite high, may lead to a form of aggregate separation when combining these larger molecules with a bunch of smaller particles. It's partially based on the concentration of the components, so yeah, the larger molecules could definitely crowd the smaller functional RNA.

With that said, the method of mRNA amplification is probably using two primers to amplify a specific region of the gene. Granted, that's more a question for the Das lab, and I'm sure these are concepts they're taking into consideration at this time.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 498 Reply Likes
Blunt end inputs behaves different to full length biomarkers


We have one further thing to take into account, when it comes to getting a good PCR product as input for our TB concentration measuring devices. If we take the full biomarker length, we won't get the same results as for the shorter biomarker cutouts that we use for lab. Here is why.

By doing a biomarker cutout, we can get it to make a direct coaxial stacking between reporter and input. Input and reporter like to sit right next to each other, for an ON state. This can't be done, when there is extra bases at the end of the input that are not used. The exact same goes for designs where the full length of the reporter is not in use. The input bases and the reporter bases can't get as close.

This is already a problem for some of our lab puzzles that makes use of an input and/or reporter, but does not use the full length of one or both ends. Such designs can never reach a KDON as low as if the input had been cut to fit perfectly for only the bases used. Or summed up:

  • No blunt end cut input, no true coaxial stacking
Photo of Omei Turnbull

Omei Turnbull, Player Developer

  • 980 Posts
  • 308 Reply Likes
Hi Eli!  Can you elaborate, or perhaps give an example?  I don't think I understand.
Photo of Eli Fisker

Eli Fisker

  • 2239 Posts
  • 495 Reply Likes
Sure, Omei!

I don't think RNA like binding up, with rather sharp bends. I think that makes the input and reporter bind less sure. So if there are no excess unused bases on either input or reporter for making the bind happen, I think it they will bind better. Although a little excess bases may be a help for a faster kickoff.


Effective binding of inputs and reporter